ID: 1083656823

View in Genome Browser
Species Human (GRCh38)
Location 11:64234076-64234098
Sequence CAACAGAGGCATCCTTCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656809_1083656823 14 Left 1083656809 11:64234039-64234061 CCTATCCCAACCACCCAGGTGCC 0: 1
1: 0
2: 3
3: 21
4: 288
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656818_1083656823 -8 Left 1083656818 11:64234061-64234083 CCTCTCCTCCAGGGCCAACAGAG 0: 1
1: 0
2: 1
3: 32
4: 347
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656811_1083656823 8 Left 1083656811 11:64234045-64234067 CCAACCACCCAGGTGCCCTCTCC 0: 1
1: 2
2: 4
3: 49
4: 440
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656808_1083656823 15 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656817_1083656823 -7 Left 1083656817 11:64234060-64234082 CCCTCTCCTCCAGGGCCAACAGA 0: 1
1: 0
2: 2
3: 41
4: 321
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656814_1083656823 1 Left 1083656814 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 5
3: 52
4: 354
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656812_1083656823 4 Left 1083656812 11:64234049-64234071 CCACCCAGGTGCCCTCTCCTCCA 0: 1
1: 3
2: 4
3: 74
4: 739
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656810_1083656823 9 Left 1083656810 11:64234044-64234066 CCCAACCACCCAGGTGCCCTCTC 0: 1
1: 0
2: 2
3: 20
4: 284
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656816_1083656823 0 Left 1083656816 11:64234053-64234075 CCAGGTGCCCTCTCCTCCAGGGC 0: 1
1: 0
2: 4
3: 60
4: 498
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656806_1083656823 29 Left 1083656806 11:64234024-64234046 CCACACTTCGGGATCCCTATCCC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656823 Original CRISPR CAACAGAGGCATCCTTCAGC AGG Exonic