ID: 1083657281

View in Genome Browser
Species Human (GRCh38)
Location 11:64235570-64235592
Sequence AGGGGAGTTACACAAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083657281_1083657285 15 Left 1083657281 11:64235570-64235592 CCATCATCTTGTGTAACTCCCCT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1083657285 11:64235608-64235630 TTATTCTACCCATTTCACAGAGG 0: 1
1: 1
2: 29
3: 171
4: 693
1083657281_1083657286 18 Left 1083657281 11:64235570-64235592 CCATCATCTTGTGTAACTCCCCT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1083657286 11:64235611-64235633 TTCTACCCATTTCACAGAGGAGG 0: 1
1: 2
2: 43
3: 497
4: 2438
1083657281_1083657289 27 Left 1083657281 11:64235570-64235592 CCATCATCTTGTGTAACTCCCCT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1083657289 11:64235620-64235642 TTTCACAGAGGAGGAAATTGAGG 0: 3
1: 64
2: 775
3: 3829
4: 11229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083657281 Original CRISPR AGGGGAGTTACACAAGATGA TGG (reversed) Intronic
906049845 1:42861325-42861347 ATGGGAGTTCCAGAAGAAGAGGG + Intergenic
912739280 1:112178494-112178516 AGGAGAGGTATACCAGATGAAGG - Intergenic
916226131 1:162491183-162491205 AGGGGAGACAGACAAGATTAAGG - Intergenic
917396559 1:174600692-174600714 GGTGGAGCTACCCAAGATGATGG - Intronic
919793847 1:201309293-201309315 AGGGGAATTACACAAGCAGGCGG + Intronic
924010895 1:239664539-239664561 AGGAGAGATTCTCAAGATGAGGG - Intronic
924656751 1:245979498-245979520 AGGAGAGTTCCACATGAAGACGG + Intronic
1064341732 10:14491887-14491909 AGGGGGTTTTCACAAGAGGATGG - Intergenic
1064536054 10:16359000-16359022 AGGAGAGTTAAACAAGATACTGG - Intergenic
1066250260 10:33626211-33626233 AGGGAAGTGAAACCAGATGATGG + Intergenic
1067658188 10:48213024-48213046 AGGGCAGTTACTCATGAGGAAGG + Intronic
1069414584 10:68186861-68186883 TGGGGAGTTACATTAGATGAAGG + Intronic
1072914143 10:99526893-99526915 AGGGGAATGAAACAAGATGAGGG + Intergenic
1075222453 10:120596914-120596936 AGGGGAGTTTCAGGAAATGATGG + Intergenic
1076437934 10:130459381-130459403 AGGGGTGTTCCCCAAGGTGAAGG + Intergenic
1078489263 11:11754273-11754295 AGGGGACTTACAGCAGGTGAGGG - Intergenic
1079793169 11:24765399-24765421 AGGGAAGTGCCAAAAGATGAAGG + Intronic
1081218563 11:40432288-40432310 AGGGGATTTCAAGAAGATGATGG - Intronic
1083302494 11:61746217-61746239 GCGGGAGTTACAGAGGATGAGGG - Exonic
1083657281 11:64235570-64235592 AGGGGAGTTACACAAGATGATGG - Intronic
1085637134 11:78167625-78167647 AGGTTAGTGTCACAAGATGAAGG + Intergenic
1085970016 11:81577480-81577502 ATGGGAGTTATACAATATAAAGG - Intergenic
1086983331 11:93222387-93222409 AGGGGAGTGTCCCAGGATGAAGG - Intergenic
1087381672 11:97411501-97411523 AAGAGAGTAAAACAAGATGAAGG + Intergenic
1089724791 11:120466586-120466608 AGAGTATTTACACAAGAGGATGG + Intronic
1092097894 12:5859443-5859465 GGGAGAGTTACCCAAGAAGACGG + Intronic
1092777100 12:11953321-11953343 AGTGGAGTTACAGAAGGTGAAGG + Intergenic
1093280484 12:17189647-17189669 AGGGAACTTACACAAGGTGAAGG - Intergenic
1096785880 12:54017070-54017092 AGGGGAGAGACAGAAGTTGAGGG + Intronic
1096896807 12:54829287-54829309 AGGGCAATTACACAAGAAAAAGG - Intergenic
1101650172 12:106670310-106670332 AGGTGAGTTACATAAGATACAGG - Intronic
1101687995 12:107044911-107044933 ATGGGAGTTTCAGAAGAAGAAGG + Intronic
1102776567 12:115524855-115524877 AGGGGGGTTAGGCAGGATGAAGG - Intergenic
1103401214 12:120644225-120644247 AGGAGGCTTACACAAGATTAAGG + Intronic
1104673537 12:130697064-130697086 AAGGGTGTCAAACAAGATGATGG + Intronic
1106071598 13:26417108-26417130 AGTGGAGTTCCACAAGAAGCAGG - Intergenic
1108570102 13:51741252-51741274 AGTGGCTTTACACAGGATGAAGG + Intronic
1109083053 13:57932089-57932111 AGGGGACTGACACAAGCTGCTGG - Intergenic
1112000223 13:95203087-95203109 AGGGGAGTTACACAAGTAAAAGG + Intronic
1112308708 13:98298795-98298817 AGGTGAGTTACACCCGCTGATGG + Intronic
1113115515 13:106870413-106870435 AAGTGAGTTACAGAAGCTGAGGG + Intergenic
1113161504 13:107386823-107386845 AGGAAAGTTATATAAGATGATGG + Intronic
1115106539 14:29768863-29768885 AGGATAGTTATACAAGAGGAGGG - Intronic
1116762441 14:49031353-49031375 AAGGTAATTACAAAAGATGATGG + Intergenic
1118041147 14:61918427-61918449 AGGGGAAATACAGAAGATGGGGG + Intergenic
1120321161 14:82962711-82962733 AGGGAAGTTTCACAAGATAAAGG - Intergenic
1125531415 15:40415938-40415960 ATGGGATTTACTCAGGATGATGG - Intronic
1127341890 15:58054615-58054637 AGCCCAGTTACACAAAATGATGG + Intronic
1130143150 15:81249316-81249338 AGAGAAGTGACCCAAGATGAAGG - Intronic
1132393643 15:101456778-101456800 AGGGGGAATACACAAGGTGAGGG + Intronic
1133663664 16:7943926-7943948 AGGGTAGTTTCAAAAGCTGAGGG - Intergenic
1134625039 16:15717475-15717497 AGTGGAGTTTTACAGGATGAAGG - Intronic
1135935688 16:26777861-26777883 GGAGGAATTACACAAGAGGAAGG + Intergenic
1135994053 16:27235197-27235219 AGAGGAGTCACGGAAGATGATGG - Exonic
1139144454 16:64307416-64307438 GTGGGAGATACACAGGATGAGGG + Intergenic
1140855755 16:78976257-78976279 AGGAGTGTTTCACAAGATGCTGG - Intronic
1203143705 16_KI270728v1_random:1785687-1785709 AGGGGAGTTGGAGAATATGATGG + Intergenic
1143729074 17:8870146-8870168 AGGGGAGTGACAATAGATGGTGG - Intergenic
1147306478 17:39567836-39567858 AGGGGAGTTCCATCAGAGGAAGG + Intergenic
1150098845 17:62403948-62403970 GGGGAAGTTACAAGAGATGAGGG - Intronic
1150576852 17:66438152-66438174 ACCGCAGTCACACAAGATGAAGG - Intronic
1151346904 17:73507865-73507887 AGGGAAGTGACAGAAGATGCTGG - Intronic
1151595536 17:75076209-75076231 AGGGGATTTTCAGAAAATGATGG - Intergenic
1153625889 18:7022132-7022154 TGGGAAGCTACACATGATGATGG - Intronic
1153928399 18:9855922-9855944 AGGGGAGGAACAAATGATGATGG - Intronic
1155977613 18:32147960-32147982 AAGAGACTTACACAAGTTGATGG - Intronic
1159120557 18:64164264-64164286 AGAGGAGTTGAAGAAGATGATGG + Intergenic
1163319346 19:16564191-16564213 ATGGGAAGTACACAAGGTGAAGG + Intronic
1165730787 19:38143350-38143372 AGGGGACATTCACAGGATGAGGG - Intronic
1166334858 19:42099630-42099652 AGGGGAAATACACAGGGTGAGGG + Intronic
1167487543 19:49771870-49771892 AGGGGAGTTACCTAGGCTGAGGG + Intronic
926005535 2:9370800-9370822 TGGAGAGTTACTCAAGGTGAAGG + Intronic
927358847 2:22208175-22208197 AGGGGACTGACATGAGATGAAGG + Intergenic
932263810 2:70349010-70349032 AGGGCAGTTACTCTTGATGAGGG + Intergenic
933330945 2:80892438-80892460 AGGGGTGTTGCAGAAGCTGAAGG + Intergenic
935559733 2:104547653-104547675 TGGGGAATTAGAAAAGATGAGGG - Intergenic
936388648 2:112053909-112053931 AGGGAAGGTACACAATAAGACGG + Intergenic
939685503 2:145194106-145194128 ATGGGAATAAGACAAGATGATGG + Intergenic
939703538 2:145422938-145422960 ATGGGAGTTCCACAAGCAGAAGG + Intergenic
940439929 2:153702358-153702380 AGGGGAGGGAACCAAGATGATGG + Intergenic
942418249 2:175781190-175781212 AGGGGAATTCCTCAAGTTGAAGG + Intergenic
943686355 2:190822765-190822787 ATGGGAGTCACAGGAGATGAGGG - Intergenic
944614318 2:201444344-201444366 AGGAGAGTGGTACAAGATGAGGG - Intronic
946142970 2:217707038-217707060 AATGGAGTCACACAATATGAAGG + Intronic
1169823547 20:9741250-9741272 AGGGAAGAAACACAAGAAGAAGG + Intronic
1171326147 20:24294980-24295002 GGGGGAGTTACAAAATAAGACGG - Intergenic
1172954110 20:38743282-38743304 AGGGGAGCACCACATGATGACGG + Intergenic
1173284468 20:41657686-41657708 TGGGGAGTTAAAGAAGCTGATGG + Intergenic
1174976962 20:55346659-55346681 AGAGGAGTGACACAAGCAGATGG - Intergenic
1177936425 21:27352159-27352181 AGGGGAGCTACACACACTGAGGG + Intergenic
1178188693 21:30255597-30255619 AAAGGAGTTAAAAAAGATGAAGG - Intergenic
1178501704 21:33131031-33131053 AAGGGAGTTACACATGTGGAAGG - Intergenic
1180227730 21:46405935-46405957 AGGAGAATTACAGAAAATGAAGG - Intronic
1184949814 22:47833274-47833296 AGGGGAGATACAGAGGAGGATGG + Intergenic
949554997 3:5145135-5145157 AGGGAAGCTCCACAACATGATGG - Intronic
950378801 3:12593755-12593777 AGGGGAGTTCCCCAAGATGGGGG + Intronic
953591525 3:44260115-44260137 AGGAAACTTACACAAGGTGAAGG - Intronic
954257373 3:49416120-49416142 AGGGGAGTTTCCAAAGATGTGGG + Exonic
956888876 3:73589798-73589820 AAGTGACTTACACAAAATGAAGG + Intronic
962300590 3:134239026-134239048 AGGGGAGAGACAAAATATGATGG + Intronic
963534692 3:146513115-146513137 AGGGGAGGAAGACAAGATTAAGG - Intergenic
966302942 3:178498839-178498861 AGGAGGGTGACACAAGGTGAGGG + Intronic
973155337 4:46944653-46944675 AAGGGAGGTAAAGAAGATGAAGG - Intronic
976908087 4:90264546-90264568 AGGAAAGTAACACAATATGAAGG - Intronic
977607868 4:99000365-99000387 AGGGGACTTACCCAAGGTCATGG - Intronic
980959133 4:139457352-139457374 AGGGGATATACACACGAGGAAGG - Intronic
982751961 4:159172867-159172889 AGGGCAGTTACAGAAAATGCTGG - Intronic
982757881 4:159245734-159245756 AGGGGAGGAATAGAAGATGATGG - Intronic
983643503 4:169966242-169966264 AGGGAAGTAAGAGAAGATGAAGG + Intergenic
984500810 4:180556374-180556396 AAGGGTGTCATACAAGATGAAGG - Intergenic
984830746 4:183970554-183970576 AGGGGAATCACACAGGAGGAAGG + Intronic
992006813 5:72486466-72486488 AGGGGAGGTACACAGGATGTTGG - Intronic
993969890 5:94406301-94406323 AGAGCAGTTACAGAAGATGGAGG - Intronic
994238718 5:97394839-97394861 AAGGGAGTTTCAAAATATGAGGG + Intergenic
994836464 5:104860727-104860749 AGGGGAGTTAAATAATATGAAGG - Intergenic
995553088 5:113299793-113299815 AGGGGAATTTATCAAGATGAGGG + Intronic
996684386 5:126264876-126264898 AGCTGAGATACACCAGATGAAGG - Intergenic
997987342 5:138513194-138513216 AGGGGAGTGAATCCAGATGATGG - Intronic
999719890 5:154391882-154391904 TGGGGACTTGTACAAGATGATGG - Intronic
1002185721 5:177454066-177454088 AGGGGAGGAAAACTAGATGAGGG - Intronic
1005944976 6:30588924-30588946 AGGGGAGTTAAGCAAAATGGAGG - Intronic
1006130246 6:31864801-31864823 AGGGGAGTCACTCACCATGATGG + Exonic
1007704232 6:43781306-43781328 AGGGCACTTCCACCAGATGAAGG - Intronic
1008363767 6:50651376-50651398 AGGGAAGTAACAAAAGAAGAAGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1009631861 6:66210288-66210310 AGGGATGTAAAACAAGATGAAGG - Intergenic
1010196445 6:73244347-73244369 TGGGGAGTTACTGAAGATTAAGG + Intronic
1011231884 6:85171071-85171093 TGTGGAGTTTCACAGGATGATGG - Intergenic
1014592437 6:123290794-123290816 AAGGGAGTTTCAAAATATGAGGG + Intronic
1015684395 6:135843269-135843291 AGCTCAGTTACACAAGATGAAGG + Intergenic
1017074978 6:150609644-150609666 AGGGGAGTAACATAACCTGATGG + Intronic
1020587206 7:10083925-10083947 AGGGGAGTCACACAAAAAGGAGG + Intergenic
1021467514 7:20962229-20962251 AGGAGTGATACACAAGAGGATGG - Intergenic
1022337820 7:29438755-29438777 AAGGGAGATACAAAATATGAAGG - Intronic
1030507780 7:110446204-110446226 AGGGGAGGTACACAGGGTAAGGG - Intergenic
1031477941 7:122245389-122245411 AGTAGAGTTACAAAAGCTGATGG - Intergenic
1033178928 7:139155300-139155322 AGGGCAGTTAGACAAGAAAAAGG - Intronic
1036662130 8:10715460-10715482 ATGGGAGGTGCACAAGATGGAGG - Intergenic
1036748126 8:11424463-11424485 AGGGGAGTCACAGAAGAGGTCGG + Exonic
1039615396 8:38951238-38951260 ACGGGAGACACAGAAGATGAGGG + Intronic
1043639215 8:82429361-82429383 AAGGGGGATACACTAGATGATGG + Intergenic
1044712573 8:95072027-95072049 ATGGGAGTAACAGAAGATGCTGG + Intronic
1050107513 9:2180944-2180966 ATGGCAGTTAGGCAAGATGAAGG + Intronic
1050694032 9:8259677-8259699 AGGGGAGTCACAAAGCATGAAGG - Intergenic
1051766475 9:20529885-20529907 AGGCCAGTTACACAAACTGAGGG + Intronic
1055794698 9:79963057-79963079 ATGGGAGTTATGCAAGCTGAAGG + Intergenic
1056202894 9:84293867-84293889 AGGGCGGTTAACCAAGATGAAGG + Intronic
1059254626 9:112918401-112918423 AAAGGAATTACACAGGATGATGG - Intergenic
1059912229 9:119057315-119057337 AGGAGAGATACAAAAAATGAAGG + Intergenic
1186054153 X:5631063-5631085 AGGCGACTTATAAAAGATGACGG - Intergenic
1195068241 X:101256217-101256239 AGGGGAGCTACAGAAGATCCTGG + Exonic
1195165664 X:102217544-102217566 AGGGGCTACACACAAGATGAAGG - Intronic
1195193194 X:102469547-102469569 AGGGGCTACACACAAGATGAAGG + Intronic
1199553279 X:149079705-149079727 AGGGGTGTTACAGGAGATTAAGG + Intergenic
1200082786 X:153587346-153587368 AGGGGAGTTCTACGAAATGAAGG + Intergenic