ID: 1083657360

View in Genome Browser
Species Human (GRCh38)
Location 11:64235956-64235978
Sequence ACACACTCCAGGCCATCGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083657360_1083657366 2 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657366 11:64235981-64236003 CCACTGGGCAGCACCAAGTCCGG 0: 1
1: 0
2: 3
3: 21
4: 208
1083657360_1083657374 24 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657374 11:64236003-64236025 GATGCAGGTACTGGGCAGGTGGG 0: 2
1: 0
2: 2
3: 19
4: 291
1083657360_1083657375 25 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657375 11:64236004-64236026 ATGCAGGTACTGGGCAGGTGGGG 0: 2
1: 0
2: 3
3: 40
4: 1031
1083657360_1083657373 23 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657373 11:64236002-64236024 GGATGCAGGTACTGGGCAGGTGG 0: 2
1: 0
2: 1
3: 30
4: 424
1083657360_1083657367 9 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657367 11:64235988-64236010 GCAGCACCAAGTCCGGATGCAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1083657360_1083657370 16 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657370 11:64235995-64236017 CAAGTCCGGATGCAGGTACTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1083657360_1083657371 20 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657371 11:64235999-64236021 TCCGGATGCAGGTACTGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 99
1083657360_1083657369 15 Left 1083657360 11:64235956-64235978 CCTGACGATGGCCTGGAGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1083657369 11:64235994-64236016 CCAAGTCCGGATGCAGGTACTGG 0: 1
1: 0
2: 0
3: 2
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083657360 Original CRISPR ACACACTCCAGGCCATCGTC AGG (reversed) Exonic
901711854 1:11122036-11122058 ACACACTGCACGCCCTCATCCGG - Exonic
902277142 1:15347966-15347988 ACACTCGCCAGGCCTTCCTCTGG - Intronic
915499987 1:156309197-156309219 ACTCACTCCTGGCCAGCATCAGG + Exonic
919817276 1:201449329-201449351 TCACACTCCAGCCCATCTCCTGG + Intergenic
920761072 1:208784165-208784187 ACACACCCCAGCCCATCCTGTGG - Intergenic
924878377 1:248130221-248130243 ACACACTTCAGGATATCATCCGG + Intergenic
1065915435 10:30350912-30350934 ACACACTCAAGGCCACCCTCAGG + Intronic
1066638686 10:37533671-37533693 ACACTCCCCAGGACATGGTCTGG - Intergenic
1067069683 10:43122439-43122461 ACTCACACAAGGCCATCTTCAGG - Intronic
1071193388 10:83128301-83128323 ACACACTCCAGGCAAGCCTCTGG + Intergenic
1078143025 11:8705335-8705357 ACTCACTCCAGCCCAACTTCTGG + Intronic
1083657360 11:64235956-64235978 ACACACTCCAGGCCATCGTCAGG - Exonic
1085023752 11:73224691-73224713 CCACACTGAAGGCCATCCTCAGG - Intronic
1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG + Intergenic
1102944446 12:116973725-116973747 ACACACTGCACTCCATTGTCAGG - Intronic
1104017963 12:124972884-124972906 ACACACTCCAGCCCATGTGCAGG - Intronic
1105753798 13:23446191-23446213 TCACACTCCTGGGCATCATCGGG + Intergenic
1106003358 13:25745616-25745638 AAACACTCCAGCCCATCCCCAGG - Intronic
1109293821 13:60505951-60505973 ACACACTTCAGGATATTGTCCGG + Intronic
1111542134 13:89682721-89682743 ACACACTCCAGGGCCTGGTAGGG + Intergenic
1111996401 13:95169685-95169707 ACAAAGTCCTTGCCATCGTCGGG - Intronic
1113584682 13:111457026-111457048 AGACACCCCAGGCCAGCGTCCGG - Intergenic
1117434082 14:55699772-55699794 ACACACACCAGGCCCTCCACAGG - Intronic
1122634198 14:103122686-103122708 CCAGACTCCAGGGCCTCGTCTGG - Intergenic
1124123404 15:26911911-26911933 ACACAGTCTATGCCATCGTCAGG - Intronic
1125932611 15:43611238-43611260 AGACACTCCAGGCCATCCCTAGG - Exonic
1125945709 15:43710700-43710722 AGACACTCCAGGCCATCCCTAGG - Intergenic
1129479832 15:75814913-75814935 ACACACTTAAGGCCACCCTCAGG - Intergenic
1132766544 16:1537261-1537283 ACGCACACCAGGCCACCCTCGGG + Intronic
1133119371 16:3596740-3596762 ACACACTCCAGACAGTCGTGCGG - Intronic
1138479014 16:57289447-57289469 AAACACTCCAGGCCTTGGCCGGG - Intergenic
1141566239 16:84903991-84904013 ACACACCTCTGGCCATTGTCAGG + Intronic
1141643916 16:85357348-85357370 ACCAAGGCCAGGCCATCGTCGGG + Intergenic
1141644265 16:85358871-85358893 ACAAAAGCCAGGCCATTGTCGGG + Intronic
1143033099 17:3978662-3978684 ACACACTCCAGGGCCTCAACTGG + Intergenic
1144717661 17:17445658-17445680 ACAGGCTCCAGCCCATCCTCAGG + Intergenic
1147118686 17:38322180-38322202 ACATACTCCAGGACATCCTTGGG - Exonic
1147320325 17:39642113-39642135 ACACACCACAGCCCATCGCCTGG - Intronic
1151933170 17:77245527-77245549 ACACACACCAGGCCAAAGGCTGG - Intergenic
1153294027 18:3528622-3528644 AAAGTCTCTAGGCCATCGTCAGG + Intronic
1153650500 18:7235643-7235665 ATACACTCCAGTCCAGCCTCTGG - Intergenic
1156248313 18:35325120-35325142 ACACCCTCCAGGCCTTTGTCAGG + Intergenic
1161126839 19:2562631-2562653 ACACACTCCATGCCAGCAGCAGG + Intronic
1161680188 19:5676279-5676301 ACTCACTCCAGGCCAGGGCCGGG + Intronic
1162553822 19:11374185-11374207 ACACACTCCGGCCCATACTCAGG + Intergenic
1165177852 19:33943184-33943206 CCACACTCAAAGCCCTCGTCTGG + Intergenic
1165313828 19:35043012-35043034 ACACACACCAGGCACTGGTCTGG + Intronic
1165591299 19:36972509-36972531 ACACCCTCCAGGCCAGCCTGTGG + Intronic
925359872 2:3270310-3270332 ACACACCCCAGGCCCTCTGCGGG - Intronic
929055677 2:37874363-37874385 TCACTCTCCATGCCTTCGTCTGG - Intergenic
932392321 2:71406176-71406198 ACACACTGAAGTCCATCTTCCGG - Exonic
935366607 2:102298288-102298310 AAACACTCCAGTCCCTAGTCTGG - Intergenic
936792790 2:116169443-116169465 ACACACACCTGACCATCTTCTGG + Intergenic
937275493 2:120681490-120681512 GCACACTCCAGGCCCTGTTCAGG - Intergenic
938243989 2:129763523-129763545 GCACACTCCATGCCACCCTCTGG + Intergenic
943749383 2:191495523-191495545 ACACATTTCAGGCCATGGTTGGG + Intergenic
946420294 2:219560996-219561018 ACAAACTCCAGCCCATGCTCAGG - Intronic
948943644 2:241208610-241208632 ACTCACTACAGGTCATCCTCTGG + Intronic
1168973478 20:1947013-1947035 ACAAATCCCAGGCCCTCGTCGGG + Intergenic
1171961413 20:31497536-31497558 AGACCCTCCAGGCCTTCCTCTGG + Intergenic
1174485603 20:50859398-50859420 TCACACACTAGGCCATCGCCAGG - Intronic
1181341822 22:22187116-22187138 CCACAGTCCAGGCCATAGCCCGG + Intergenic
1184489230 22:44799595-44799617 ACCCACACCAGGCTGTCGTCAGG - Intronic
952029827 3:29128249-29128271 ACAGACTCCAGGCCAGCTGCAGG + Intergenic
954871127 3:53768197-53768219 AGACACTCCTGGCCACAGTCTGG - Intronic
955992427 3:64642479-64642501 ACACACTCCAGGAAAGCGTCAGG + Intronic
957438746 3:80214895-80214917 ACAAACTACAGGCCATTGTAGGG - Intergenic
961386567 3:126526343-126526365 AGACACTGCAGGCCCTCGTGAGG - Intronic
961663743 3:128483990-128484012 ACACACTCCCGGCCTTCTGCAGG + Exonic
962874139 3:139522854-139522876 ACATGCTCCAGGCCACAGTCTGG - Intronic
964310469 3:155386566-155386588 ACACATTCCAGGCCCTTGCCTGG - Intronic
967009862 3:185422778-185422800 CCAACCTCCAGGCCATGGTCTGG + Intronic
979858609 4:125665205-125665227 ACACTCTGCAGGCCATCAGCTGG + Intergenic
984606409 4:181790185-181790207 ACACACACCAAGCAATCCTCCGG - Intergenic
985911487 5:2887421-2887443 ACACACTCCAGGCTACCACCAGG - Intergenic
986161666 5:5235003-5235025 ACACATTCCAGGCCATCGCATGG + Exonic
991127219 5:63082977-63082999 ACACAGACCTGGACATCGTCAGG - Intergenic
996890748 5:128416484-128416506 AAACACTCCAGGACATTGTCTGG - Intronic
1001584481 5:172824086-172824108 GCAGACTGCAGGCCATCGTAAGG + Intergenic
1007324781 6:41051634-41051656 AAACACTCTAGGCCATTCTCAGG - Intronic
1009561777 6:65255429-65255451 AAACACTCCAGGACATTGTCTGG + Intronic
1016804751 6:148201692-148201714 ACACCCTCCAGGTCTTCGACAGG - Intergenic
1018182827 6:161239135-161239157 ACACACTCCAGCACAGCGTTTGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1028398598 7:90400184-90400206 AAACCCTCCAGGACATTGTCTGG + Intronic
1029818525 7:103122348-103122370 ACACTCTCCATGCCATCATTTGG - Intronic
1035283841 7:157794001-157794023 CCACCCTCCAGGCCACCTTCGGG + Intronic
1043582683 8:81732450-81732472 ACACACTCCAGGGCATTTCCTGG - Exonic
1055344958 9:75326250-75326272 ACACACTTCAGGATATTGTCCGG - Intergenic
1058746341 9:107994784-107994806 ACACACAACTGGCCATCGTATGG - Intergenic
1062480497 9:136748678-136748700 ACACACTCCAGACCCTCTCCTGG - Intergenic
1190766295 X:53478496-53478518 ACTCTCTCCAGGCCATCATATGG - Intergenic
1192502013 X:71660641-71660663 GTACACCCCAGGCCATGGTCAGG - Intergenic
1193038128 X:76975482-76975504 AAAACCTCCAGGCCATCCTCTGG - Intergenic