ID: 1083662637

View in Genome Browser
Species Human (GRCh38)
Location 11:64258918-64258940
Sequence GCGCGTCTCCAAAGATGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083662637_1083662647 27 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662647 11:64258968-64258990 CGGTACGGGAGCTCGGAGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1083662637_1083662640 7 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662640 11:64258948-64258970 CGAGCCTCTGGACAAGTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 73
1083662637_1083662639 -5 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662639 11:64258936-64258958 CGCGCTACTCATCGAGCCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 15
1083662637_1083662642 12 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 51
1083662637_1083662649 29 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662649 11:64258970-64258992 GTACGGGAGCTCGGAGCGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 58
1083662637_1083662644 20 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662644 11:64258961-64258983 AAGTACCCGGTACGGGAGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 27
1083662637_1083662650 30 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662650 11:64258971-64258993 TACGGGAGCTCGGAGCGAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1083662637_1083662648 28 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662648 11:64258969-64258991 GGTACGGGAGCTCGGAGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1083662637_1083662643 13 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662643 11:64258954-64258976 TCTGGACAAGTACCCGGTACGGG 0: 1
1: 0
2: 1
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083662637 Original CRISPR GCGCGTCTCCAAAGATGGAG CGG (reversed) Exonic
902514821 1:16984463-16984485 GCACATCTCCAAAGACGTAGTGG - Intergenic
903200236 1:21731296-21731318 GCTCGTCTCCCAGGCTGGAGTGG + Intronic
907530453 1:55090564-55090586 GAGCTTCTCCAAGTATGGAGAGG - Intronic
911973542 1:104464956-104464978 GTGCCTCCCCAAAGATGGTGGGG + Intergenic
924500075 1:244629320-244629342 GTGCTTCTCCAAATATGCAGAGG - Intronic
1062950483 10:1497376-1497398 GTGAGTCTCTAAAAATGGAGAGG - Intronic
1067200921 10:44171587-44171609 GAGAGGCTCCAAAGAGGGAGAGG + Intergenic
1077264072 11:1640408-1640430 CCCAGTCTCCAAAGATTGAGTGG + Intergenic
1081793476 11:45804765-45804787 GCGAGTCTCCGGAGGTGGAGGGG + Exonic
1083662637 11:64258918-64258940 GCGCGTCTCCAAAGATGGAGCGG - Exonic
1084261309 11:67980556-67980578 ACGCCTCCCCAAAGATGGTGGGG + Intergenic
1093289120 12:17300390-17300412 GCGCCTCCCTAAAGATGGTGGGG - Intergenic
1104292728 12:127484359-127484381 GTGCCTCCCCAAAGATGGTGAGG - Intergenic
1110661049 13:78059779-78059801 GGGCCGCTCCCAAGATGGAGTGG - Intergenic
1125703829 15:41713242-41713264 GCGCTTCTCCAAAGCTAGACTGG - Exonic
1127867342 15:63043077-63043099 GCGCGTCTGGAAAGAAGGAAGGG + Intronic
1129143403 15:73623975-73623997 GGCAGTCTCCAAAGATGGATGGG - Intronic
1130663436 15:85849814-85849836 GCATGTCTTCAAAAATGGAGAGG + Intergenic
1139846704 16:69926425-69926447 GCTCGACAACAAAGATGGAGAGG + Intronic
1141361276 16:83397143-83397165 GTGTGTCCCCAAAGAAGGAGGGG - Intronic
1142095111 16:88235166-88235188 GGGCCTCTCCAGGGATGGAGAGG + Intergenic
1148587780 17:48793212-48793234 GATTGTCTCAAAAGATGGAGAGG + Intronic
1149075952 17:52596293-52596315 GTGCCTCCCCAAAGATGGTGGGG - Intergenic
1156141343 18:34115331-34115353 GCACGTCACCCAAGCTGGAGTGG + Intronic
1162480064 19:10922623-10922645 GAGCGTCTACAAGGATGGAGGGG - Exonic
1162809165 19:13153939-13153961 GCGCTTCCCCCAGGATGGAGGGG - Exonic
1163966549 19:20752014-20752036 ACGCCTCCCCAAAGATGGTGGGG + Intronic
940238060 2:151531730-151531752 GGGCATCTGCAAACATGGAGGGG - Intronic
942750123 2:179277366-179277388 ACTCCTCTCCAAAGGTGGAGGGG - Intergenic
1170322028 20:15110724-15110746 GCGTGTCTCTGAACATGGAGAGG + Intronic
1181491318 22:23262533-23262555 GGGGGGCTTCAAAGATGGAGGGG - Intronic
953498172 3:43406776-43406798 GCCCATTTCCAAAGATGGAGAGG - Intronic
954617345 3:51976048-51976070 GCGCTTCTCCAAAGCGGGAAGGG - Intronic
957022329 3:75139739-75139761 GCACCTCCCCAAAGATGGTGGGG - Intergenic
961329836 3:126131990-126132012 TGGCATCTCCAGAGATGGAGAGG + Intronic
963035826 3:141027881-141027903 GCAAGTCTCCCAATATGGAGTGG - Intergenic
993328325 5:86568220-86568242 GCGCCTCCCCGAAGATGGTGGGG + Intergenic
1001755004 5:174161502-174161524 GGGCTTCTCCCAAGATGAAGGGG + Intronic
1002559734 5:180072902-180072924 GCGCGTTTCGGAAGGTGGAGGGG - Intergenic
1003581005 6:7340903-7340925 GCTCGTCTGCAAAGATGAGGTGG + Intronic
1008994634 6:57644328-57644350 TTGCGTCTGGAAAGATGGAGAGG - Intronic
1010471588 6:76234361-76234383 GCTAGTCACCACAGATGGAGTGG - Intergenic
1011565176 6:88665721-88665743 GTGCCTCCCCAAAGATGGTGGGG - Intronic
1016295777 6:142572519-142572541 GAGCCTCTCCTAAGATGGAGAGG + Intergenic
1018005694 6:159619782-159619804 GCGCGTCTCCAACACTGGAGGGG - Intergenic
1019755066 7:2762836-2762858 GCGCGGCTCCGAAGCAGGAGAGG + Intronic
1026516480 7:71077783-71077805 GCATTTCTCCAAAGATTGAGAGG + Intergenic
1028147002 7:87329723-87329745 GGGCAGCTCCCAAGATGGAGGGG + Intergenic
1029926837 7:104328126-104328148 GTGCCTCTGCAAAGATGCAGAGG + Intergenic
1032623407 7:133561807-133561829 GCGCGTGCCCCAAGATGGAATGG + Intronic
1032905205 7:136356843-136356865 GTGACTCTCCAAAGATGGAGAGG + Intergenic
1036833143 8:12037469-12037491 CCGCATATCCAAAGAGGGAGAGG + Intergenic
1037960432 8:23093376-23093398 GTCCCCCTCCAAAGATGGAGAGG + Intronic
1037968161 8:23149761-23149783 GCCAGTCTCCAAAGCTGGACAGG - Intronic
1038561886 8:28587997-28588019 GGCTGTCTGCAAAGATGGAGGGG + Intergenic
1039102129 8:33951846-33951868 GCACTGCTCCAAAGAGGGAGAGG - Intergenic
1039278198 8:35955061-35955083 TTGCCTCTCCAAAGATGGTGGGG - Intergenic
1043230986 8:77800554-77800576 GCACTGCTCCAAAGAGGGAGAGG - Intergenic
1048876487 8:138840365-138840387 GGGAGACTCCAAAGAGGGAGGGG + Intronic
1055928286 9:81533026-81533048 GAAAGTCTCCAAAGAAGGAGTGG + Intergenic
1189153294 X:38729621-38729643 GTCCTCCTCCAAAGATGGAGGGG - Intergenic
1190138014 X:47815108-47815130 GCGGCTCTCCAAAGATAGAAGGG + Intergenic
1197296828 X:124729515-124729537 GCACATTGCCAAAGATGGAGAGG - Intronic
1202037129 Y:20646770-20646792 GTGCCTCCCCAAAGATGGTGGGG - Intergenic