ID: 1083662638

View in Genome Browser
Species Human (GRCh38)
Location 11:64258923-64258945
Sequence GAGTAGCGCGTCTCCAAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 53}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083662638_1083662650 25 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662650 11:64258971-64258993 TACGGGAGCTCGGAGCGAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1083662638_1083662652 29 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662652 11:64258975-64258997 GGAGCTCGGAGCGAGGGGGGTGG 0: 1
1: 0
2: 1
3: 35
4: 453
1083662638_1083662651 26 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662651 11:64258972-64258994 ACGGGAGCTCGGAGCGAGGGGGG 0: 1
1: 1
2: 0
3: 8
4: 139
1083662638_1083662647 22 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662647 11:64258968-64258990 CGGTACGGGAGCTCGGAGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1083662638_1083662642 7 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 51
1083662638_1083662644 15 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662644 11:64258961-64258983 AAGTACCCGGTACGGGAGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 27
1083662638_1083662648 23 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662648 11:64258969-64258991 GGTACGGGAGCTCGGAGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1083662638_1083662643 8 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662643 11:64258954-64258976 TCTGGACAAGTACCCGGTACGGG 0: 1
1: 0
2: 1
3: 3
4: 84
1083662638_1083662639 -10 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662639 11:64258936-64258958 CGCGCTACTCATCGAGCCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 15
1083662638_1083662649 24 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662649 11:64258970-64258992 GTACGGGAGCTCGGAGCGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 58
1083662638_1083662640 2 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662640 11:64258948-64258970 CGAGCCTCTGGACAAGTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083662638 Original CRISPR GAGTAGCGCGTCTCCAAAGA TGG (reversed) Exonic
901141477 1:7035715-7035737 GAGTAGCAGTTCTCCAAATATGG - Intronic
903300151 1:22373048-22373070 CAGTAACTGGTCTCCAAAGATGG + Intergenic
907472451 1:54682747-54682769 GAGAAGCCCGTCACCAAGGAGGG + Exonic
911019497 1:93372678-93372700 TGGTAGCTAGTCTCCAAAGATGG - Intergenic
914905528 1:151740538-151740560 CAGTAGCAGGGCTCCAAAGAAGG + Intergenic
916348764 1:163825100-163825122 TAGTAGCTTGTCTCCAAAGATGG + Intergenic
916590867 1:166188845-166188867 CAGTAGCTCGTCTCCAAAGATGG - Intergenic
1064086704 10:12350521-12350543 GGGGAGCGCGTCTCCAAGGGAGG + Intronic
1075640071 10:124058203-124058225 GAGAAGCGCGTCTACCAAAATGG + Intronic
1077903399 11:6509239-6509261 GAGTAGCCCAGCTCCAAAGTGGG - Exonic
1081889222 11:46526266-46526288 GAGTAGTCAATCTCCAAAGATGG + Intronic
1083662638 11:64258923-64258945 GAGTAGCGCGTCTCCAAAGATGG - Exonic
1089571077 11:119410212-119410234 TGGTAGCTAGTCTCCAAAGATGG - Intergenic
1091613047 12:2027897-2027919 GAGCAGCTTGTCTCCCAAGAGGG + Intronic
1091789166 12:3261521-3261543 GAGAACTGCGTCTCCAAAGTAGG + Intronic
1097322535 12:58242174-58242196 GAGTATTGCTTCTCCAAAAAGGG + Intergenic
1101212399 12:102547336-102547358 TAGCAGAGAGTCTCCAAAGATGG - Intergenic
1102589826 12:113948832-113948854 GAGAAGCTCTTCTCCAAATATGG - Exonic
1109949569 13:69483357-69483379 GAGTAGCGCTTCTCCCAACACGG - Intergenic
1111779809 13:92708022-92708044 GAATAGAGCATTTCCAAAGATGG + Intronic
1116858779 14:49977327-49977349 CAGTAGATAGTCTCCAAAGATGG - Intergenic
1118351303 14:64973998-64974020 GAGGTGCGCGTCTCCACAGTGGG + Intronic
1125831205 15:42718273-42718295 GAGTACCTGGCCTCCAAAGAGGG - Intronic
1126435737 15:48636027-48636049 TGGTAGCTGGTCTCCAAAGATGG + Intronic
1127869087 15:63055328-63055350 GAGTAGGGCATCTCCAACCACGG - Intronic
1141105614 16:81231166-81231188 GGGTAGCTAGTTTCCAAAGATGG + Intergenic
1144302912 17:13939418-13939440 GAGCAGTGGGGCTCCAAAGAAGG + Intergenic
1144374542 17:14626358-14626380 GAGTAGAGAGTCACCAAAAATGG - Intergenic
1146210467 17:30938531-30938553 GGGTAGATGGTCTCCAAAGATGG - Intronic
1148677624 17:49454287-49454309 GAGTGCCGGGGCTCCAAAGAGGG - Intronic
943722117 2:191216031-191216053 GAGTATTGACTCTCCAAAGATGG - Intergenic
947625226 2:231614539-231614561 GAGCAGCGCGTCTGGAGAGAGGG - Intergenic
1172789463 20:37492695-37492717 TGGTAGCTAGTCTCCAAAGATGG - Intronic
1182208497 22:28653167-28653189 GAGTAGACCTGCTCCAAAGAGGG - Intronic
949205988 3:1439673-1439695 GAGTGGAGGGTCTACAAAGAAGG + Intergenic
950799604 3:15539451-15539473 TAGTAGCTGGTCTCCAAAGATGG + Intergenic
953457062 3:43051920-43051942 GACTAGCCCTTCTGCAAAGATGG + Intronic
971286449 4:25294673-25294695 GAGTGGATAGTCTCCAAAGATGG + Intergenic
974422462 4:61695436-61695458 GAGTAGCAGGTCTCCACAGTGGG + Intronic
982122814 4:152158756-152158778 CAGGAGCCCATCTCCAAAGATGG + Intergenic
983546295 4:168967943-168967965 TGGTAGCTCATCTCCAAAGACGG + Intronic
983654472 4:170068456-170068478 GATTAGCATGTCTGCAAAGAAGG + Intronic
992253848 5:74902108-74902130 CAGCAGCCAGTCTCCAAAGATGG + Intergenic
994518295 5:100797314-100797336 GAGTAGCCCACCTCCAAAGAAGG - Intergenic
998063631 5:139138857-139138879 GGGAAGCTAGTCTCCAAAGAGGG - Intronic
1000413737 5:160961545-160961567 GAATAGCAGGTCTCCAAAGGAGG - Intergenic
1003320558 6:5047182-5047204 TGGTAGCTAGTCTCCAAAGACGG - Intergenic
1008044225 6:46835329-46835351 GAGCAGCAGGTCTCCGAAGAAGG + Exonic
1011397813 6:86928378-86928400 GAGTAGAGAGTCACCAAAAATGG + Intergenic
1014847644 6:126298221-126298243 TAGTTGCTCGTCTCCAAAGGTGG - Intergenic
1017634162 6:156427223-156427245 TAGTAGGTGGTCTCCAAAGATGG + Intergenic
1021865483 7:24952569-24952591 GAGTACCTAGTCTCCAAAGGTGG - Intronic
1028482055 7:91317707-91317729 TGGTAGCTCGTCTCCAAAGTTGG - Intergenic
1041842990 8:62293731-62293753 GAGTAGTGCTTCTCCAAGCACGG - Intronic
1053653373 9:40191662-40191684 GAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1053903777 9:42820952-42820974 AAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1054531211 9:66184556-66184578 GAGCAGCAGGTCTCCAAAGAAGG + Intergenic
1056154380 9:83819521-83819543 GAGTAGCGAGACTCTAAAGAGGG - Intronic
1193554198 X:82932937-82932959 GAGTAGCTCCTCTCCACAGCTGG - Intergenic
1196492509 X:116284893-116284915 GAGTAGCGGTTGTTCAAAGATGG - Intergenic
1202341497 Y:23873829-23873851 GGGTAGCGCCTCTCCACAGTAGG - Intergenic
1202529269 Y:25796257-25796279 GGGTAGCGCCTCTCCACAGTAGG + Intergenic