ID: 1083662642

View in Genome Browser
Species Human (GRCh38)
Location 11:64258953-64258975
Sequence CTCTGGACAAGTACCCGGTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083662637_1083662642 12 Left 1083662637 11:64258918-64258940 CCGCTCCATCTTTGGAGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 51
1083662638_1083662642 7 Left 1083662638 11:64258923-64258945 CCATCTTTGGAGACGCGCTACTC 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083662642 Original CRISPR CTCTGGACAAGTACCCGGTA CGG Exonic
903020728 1:20391997-20392019 TTCTGGATAAGTAACCTGTAGGG - Intergenic
912384761 1:109265788-109265810 CTCTGGACAAGGAGCCTGTGGGG - Exonic
915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG + Intronic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1073280499 10:102350536-102350558 CTCAGAACAAGAACCAGGTAGGG - Intronic
1074617484 10:115083943-115083965 CTCTGCACAAGGACCCAGTGGGG - Intergenic
1076697097 10:132252116-132252138 CTCTGGCCAAGAACCCGCTAGGG + Intronic
1079091626 11:17484625-17484647 CTCTGGCCAAGTACCAGAGAAGG - Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1093965039 12:25315433-25315455 CTCTGGGTAGGTACCCAGTAGGG - Intergenic
1095049688 12:37544811-37544833 CTCTGGACAAGCCACCGGTTCGG + Intergenic
1097279561 12:57836333-57836355 CTCTCAAGAAGTACCAGGTAAGG + Intronic
1102202047 12:111063945-111063967 GTCTGGACATGCACCCGGCAAGG + Intronic
1106585526 13:31053511-31053533 CTGTGGACAAGTGCCTGGGAAGG - Intergenic
1109759260 13:66805601-66805623 CAGTGGACAAGTACCTGGTTGGG - Intronic
1115669108 14:35588744-35588766 CTCTGGATATATACCCAGTAGGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG + Intronic
1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG + Intergenic
1130684442 15:86024521-86024543 GTCTGGACAAGAACCAGGTGAGG + Intergenic
1140272246 16:73477654-73477676 CTCTGCACTGGTAGCCGGTAGGG + Intergenic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1144843082 17:18200581-18200603 CTCTGTGCTAGTACCCGGAATGG + Intronic
1145386082 17:22412468-22412490 CTCTGGACAAGTCACCAGTTTGG + Intergenic
1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG + Intronic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1151433984 17:74082862-74082884 CTCTTCACAAGTCCCCGGCAAGG - Intergenic
1151851664 17:76694213-76694235 CTCAGGACAAGCACATGGTAGGG - Intronic
1162251281 19:9445760-9445782 ATCTGGACAATTACCCAGTTGGG + Intergenic
1165595879 19:37011005-37011027 CTCTGGACAAGTCACCTGTTTGG + Intronic
932766650 2:74474789-74474811 CTCCTGACAAGCACCTGGTAAGG + Exonic
946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG + Exonic
1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG + Intergenic
1175187109 20:57186238-57186260 CTGTGCAGGAGTACCCGGTAAGG + Intronic
1177174496 21:17689526-17689548 CTCTGGGCAAGAACTCGGGAGGG - Intergenic
1178283777 21:31307728-31307750 CTCTGGACAAGTGAGGGGTAAGG + Intronic
951109378 3:18784126-18784148 CTCTGTATAAGTACCCTGAAGGG + Intergenic
971091208 4:23347700-23347722 CTCTGAAAAAGTCCACGGTACGG + Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
981492892 4:145359550-145359572 CACTGGACAAGTTCCCATTAAGG + Intergenic
1000628468 5:163565823-163565845 CTCTGAACGCGTGCCCGGTATGG - Intergenic
1006716440 6:36123674-36123696 CTCTGGACAATGACTCTGTAAGG - Intergenic
1007343226 6:41207111-41207133 CTCTGTATATGTACCCGGGAAGG + Intergenic
1019350618 7:552373-552395 CTCTGGAGAAGGACCCGGGCGGG - Intronic
1031889583 7:127278512-127278534 CTATGGAAGAGAACCCGGTAGGG + Intergenic
1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG + Intergenic
1040466478 8:47700340-47700362 CACTGGCCAAGTACTCAGTAAGG + Intronic
1040568858 8:48590787-48590809 CTCATGACAGGTACCCTGTAAGG - Intergenic
1053753767 9:41281115-41281137 CTCTGGACAAGTGCTGGGAAGGG - Intergenic
1054259288 9:62845475-62845497 CTCTGGACAAGTGCTGGGAAGGG - Intergenic
1054332489 9:63774562-63774584 CTCTGGACAAGTGCTGGGAAGGG + Intergenic
1058119113 9:101119147-101119169 CTGTGGACAAGAACATGGTAAGG - Intronic
1059884619 9:118731973-118731995 CACTGGACAAGGACCTGGTCAGG - Intergenic
1189955408 X:46272436-46272458 CTCTGTGCAAATACCCTGTAGGG + Intergenic
1197610301 X:128630954-128630976 CACTGGACATCTACCAGGTATGG - Intergenic