ID: 1083662907

View in Genome Browser
Species Human (GRCh38)
Location 11:64260058-64260080
Sequence CTGAGCAATGGGGAGGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 569}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083662896_1083662907 1 Left 1083662896 11:64260034-64260056 CCCAGCTCTGACAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 42
4: 396
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569
1083662890_1083662907 28 Left 1083662890 11:64260007-64260029 CCTGTGGCCCTGTCCTCTGCAGG 0: 1
1: 0
2: 1
3: 43
4: 369
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569
1083662894_1083662907 20 Left 1083662894 11:64260015-64260037 CCTGTCCTCTGCAGGGTCTCCCA 0: 1
1: 0
2: 3
3: 43
4: 298
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569
1083662898_1083662907 0 Left 1083662898 11:64260035-64260057 CCAGCTCTGACAGCTGCCCAGGC 0: 1
1: 0
2: 7
3: 39
4: 362
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569
1083662895_1083662907 15 Left 1083662895 11:64260020-64260042 CCTCTGCAGGGTCTCCCAGCTCT 0: 1
1: 0
2: 5
3: 41
4: 373
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569
1083662893_1083662907 21 Left 1083662893 11:64260014-64260036 CCCTGTCCTCTGCAGGGTCTCCC 0: 1
1: 0
2: 2
3: 53
4: 388
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569
1083662889_1083662907 29 Left 1083662889 11:64260006-64260028 CCCTGTGGCCCTGTCCTCTGCAG 0: 1
1: 0
2: 4
3: 49
4: 428
Right 1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG 0: 1
1: 0
2: 5
3: 71
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083662907 Original CRISPR CTGAGCAATGGGGAGGAGGT AGG Exonic
900365795 1:2311485-2311507 CAGTGCAGTGGGGAGGAGTTGGG + Intergenic
900643229 1:3697188-3697210 CTGAGCAGTGGGTGCGAGGTGGG - Intronic
900839719 1:5038470-5038492 CTGATAAGTGGGGAGGAGGTGGG - Intergenic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901341105 1:8500293-8500315 CTCAAGAATGGGGGGGAGGTTGG - Intronic
901624963 1:10618617-10618639 CTGAGCACTGGAGAAAAGGTGGG - Intronic
902376781 1:16033582-16033604 CAGAGAAAGGGGGTGGAGGTGGG - Intronic
902421870 1:16287127-16287149 GTGAACAAAGGAGAGGAGGTTGG - Intronic
902649101 1:17825064-17825086 CTGAGGAATGGGGGGCAGGGGGG + Intronic
902839494 1:19066150-19066172 CTGAGTCCTGGGGAGGGGGTGGG - Intergenic
903008655 1:20315161-20315183 CTGAACGATGCGGAGGATGTAGG + Intronic
903146864 1:21379057-21379079 CTGAGCATTGGTGAGGATTTAGG + Intergenic
903192158 1:21662938-21662960 CTGAGCAATTGGATGCAGGTGGG - Intronic
903760215 1:25692565-25692587 CTGTGCAATGGGGATAAGATGGG - Intronic
903892189 1:26577286-26577308 CTGAGCAAAGATGAGGGGGTGGG + Intergenic
903934706 1:26887452-26887474 ATGAGCAATAGGGAGGTTGTTGG - Intronic
904115950 1:28162077-28162099 CTGAGCCATGGTAAGGAGTTGGG + Intronic
904317236 1:29673391-29673413 CAGAGCTTTGGGGAGGAGTTAGG - Intergenic
904370525 1:30045012-30045034 CTGAGGACTGGTGTGGAGGTGGG - Intergenic
904479764 1:30786563-30786585 CTGAGCAAGGAGGTGGAGGGAGG + Intergenic
904697338 1:32337689-32337711 CTGTGAAATGGGGCGGGGGTGGG - Intergenic
904700986 1:32357954-32357976 CTGAGGAATGGGGAGGGGCCAGG - Intronic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
904896692 1:33823157-33823179 CTGAGGAAAGGGGAGGCGGTAGG - Intronic
904983316 1:34524631-34524653 CTGAGCAATGGGGTGCATGGTGG - Intergenic
905272161 1:36794172-36794194 CTGCAGAATGGAGAGGAGGTCGG - Intergenic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
906206588 1:43990679-43990701 CTGGGCTAGGGGGAGGGGGTCGG - Exonic
906634194 1:47397340-47397362 CTCAGTGATGGGGAAGAGGTGGG - Intergenic
908798502 1:67854879-67854901 GGGAGGAATGGGCAGGAGGTAGG - Intergenic
910197633 1:84660290-84660312 CTGAGTAATGGGGGTGAGGAGGG + Intronic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
911657381 1:100460529-100460551 GTGAGGAATGGGGAGGAGAAGGG - Intronic
912115025 1:106395168-106395190 CAGAGCAAAGGGGATGAGGGTGG - Intergenic
912392186 1:109310962-109310984 CAGAGCAAGAGAGAGGAGGTGGG + Exonic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912776218 1:112508049-112508071 AGGAGCAGTGGGGAGGAGGCAGG + Intronic
913693140 1:121298621-121298643 ATGAGCAATTGGGAGGATGTTGG + Intronic
914144415 1:144981459-144981481 ATGAGCAATTGGGAGGATGTTGG - Intronic
914255250 1:145957438-145957460 CTCAGTAAAGGGGAGGAGGTAGG + Intronic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914705567 1:150167162-150167184 CTTGGCATTGGGGAGGGGGTCGG - Intergenic
915389354 1:155527407-155527429 CTTAGCAATGTGGAGGTTGTTGG - Intronic
915446053 1:155975665-155975687 CTGAGGAATGGAGAGGTGGCTGG - Intronic
915513923 1:156401845-156401867 CAGAGGGAAGGGGAGGAGGTGGG + Intergenic
915599394 1:156913067-156913089 ATGAGGAGTGGGGAGGAGGGAGG + Intronic
915721019 1:157985711-157985733 CTGAACAATAGGATGGAGGTTGG + Intergenic
916132502 1:161623718-161623740 CTGAGGATTGGGGTGGGGGTGGG - Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916763003 1:167833798-167833820 GTAAGCCATGGTGAGGAGGTTGG + Intronic
917587529 1:176442892-176442914 CTGTGGAATGGGGAAAAGGTAGG - Intergenic
917731180 1:177876622-177876644 CTGGGCAGTGGGGAGGAGGCTGG + Intergenic
918048392 1:180954588-180954610 CGGAGGGATGGGGAGGAAGTGGG + Intergenic
918302148 1:183214299-183214321 CTGAGGACTGGGGAAGGGGTGGG + Intronic
919414294 1:197287829-197287851 CTGAGCAAGATGGAGTAGGTGGG + Intronic
919782631 1:201230707-201230729 ATGAGCAAAGGCAAGGAGGTAGG + Intergenic
920258384 1:204672299-204672321 TTAAGCAATGGGGAGGGGGAAGG - Intronic
920284177 1:204867964-204867986 CTCAGCACTGAGTAGGAGGTAGG - Intronic
920480464 1:206316991-206317013 ATGAGCAATTGGGAGGATGTTGG + Intronic
920539136 1:206764307-206764329 CAGGGCAAAGGGGAGGAGTTGGG - Intergenic
921052064 1:211517850-211517872 CTGAGCCAGTGGGAGAAGGTGGG + Intergenic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922564478 1:226592821-226592843 CTGAGGAATGGGGGAGATGTGGG - Intronic
923141036 1:231162022-231162044 GAGAGTAATGGGGAGGAGGGGGG - Intergenic
923183696 1:231549104-231549126 CTGAGAAAAGGGGATGTGGTGGG + Intronic
924464942 1:244291278-244291300 CTGCTGAATGGGGAGGAGTTTGG + Intergenic
924945298 1:248842507-248842529 CTGAGCAATGAGTACGAGGGAGG + Intronic
1062927288 10:1326842-1326864 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927305 10:1326896-1326918 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927311 10:1326914-1326936 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927336 10:1326986-1327008 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927353 10:1327040-1327062 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927359 10:1327058-1327080 CTGTGCAGTGGGGAGGCGCTGGG - Intronic
1062927428 10:1327415-1327437 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927450 10:1327505-1327527 CTGTGCCATGGGGAGGCGCTGGG - Intronic
1063092152 10:2874761-2874783 CTGAGCACAGGAGAGAAGGTTGG - Intergenic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1064121374 10:12622826-12622848 CTGAGTAGAGGGGAGGATGTAGG + Intronic
1064196032 10:13244729-13244751 CTGAGCAATGGGGAGTATGGGGG - Intergenic
1066048524 10:31615272-31615294 CTGAGCTCTGGGGAGGTAGTGGG + Intergenic
1066379099 10:34886059-34886081 CAGAGCCTTAGGGAGGAGGTGGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066460063 10:35605417-35605439 CTGAGCCAGGAGTAGGAGGTGGG - Exonic
1067528561 10:47053548-47053570 CTGAGCCATGGGGAGGTGTTGGG + Intergenic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1067925698 10:50505957-50505979 CTGAGCAACTGGGAGAAGGCTGG - Intronic
1068517742 10:58044954-58044976 CTGAGAAATGGGGACTAGGAAGG + Intergenic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069694533 10:70376932-70376954 CAGGGCATTGGGAAGGAGGTAGG + Intronic
1069882887 10:71604643-71604665 CTGAGCAAAAGGGTGGAGGTGGG - Intronic
1070219170 10:74422762-74422784 ATGAGTACTGGGGAGCAGGTAGG - Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070551242 10:77492250-77492272 TTGAGCAGAGGGGAGGATGTGGG - Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1072253474 10:93600195-93600217 CTGAGGTTTGGGGAGGGGGTAGG + Intronic
1072736300 10:97881847-97881869 CTGAGGAATGAGGAGCAGTTCGG - Intronic
1073036083 10:100565071-100565093 CAGAGAAATGGGGAGAAGGAGGG + Intergenic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073523428 10:104156212-104156234 TTAAGCAATGGGGAAGAGGCTGG - Intronic
1073708822 10:106016433-106016455 CAGAGCAGTGGGGGGGATGTTGG + Intergenic
1074701069 10:116093083-116093105 ATAAGCACTGGGGAGGAGGGAGG - Intronic
1074917156 10:117968603-117968625 CCAAACCATGGGGAGGAGGTGGG - Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075279108 10:121123464-121123486 CAGAGCAATGGAGAAGAGGTGGG + Intergenic
1075745494 10:124724539-124724561 CTGAGCTATGGGGGCGGGGTAGG + Intronic
1075925146 10:126245501-126245523 CTGGGCAGTGGGCAGGAGGTCGG + Intronic
1076822800 10:132948764-132948786 CTTATCAAGGGGAAGGAGGTAGG - Intergenic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078368854 11:10728679-10728701 CAGAAAAATGGGGTGGAGGTGGG + Intergenic
1078659729 11:13277528-13277550 CTGACCAATGGCGAGGCGGCGGG - Intronic
1078987230 11:16607779-16607801 CTGAGCGAGGGAGAGGAGGCTGG + Intronic
1079201869 11:18383540-18383562 CTGAGGAAAGGGGAGGAATTTGG + Intergenic
1080788523 11:35498715-35498737 TTGAGAAATGGAGAGAAGGTGGG - Intronic
1081279096 11:41186612-41186634 CTGAACACTGGGTCGGAGGTGGG + Intronic
1081769880 11:45643404-45643426 CTGAGCACTGGAAAGCAGGTTGG - Intergenic
1081984111 11:47289218-47289240 CATGGCAATGTGGAGGAGGTGGG - Intronic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082798067 11:57392851-57392873 TTGAGCAAAGGTGTGGAGGTTGG + Intronic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1083692092 11:64415519-64415541 CTGAGGAGAGGGGAGGAGGTGGG + Intergenic
1084122433 11:67077508-67077530 CTGAGCGAAGGCTAGGAGGTTGG - Intergenic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1084184993 11:67466803-67466825 CTGAGCAATGGGTAGGAGAGGGG + Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1084527671 11:69706726-69706748 ATGGGCAATGGGTAGCAGGTAGG + Intergenic
1085252537 11:75153097-75153119 CTGAGCAAAGGTGAACAGGTGGG - Intronic
1085386665 11:76161700-76161722 CAGAGCAGAGGGGAGGGGGTGGG - Intergenic
1085688864 11:78649662-78649684 CTTAGCCATGGGCAGGACGTGGG + Intergenic
1085839939 11:80000264-80000286 CTGTGCAATGGGAAGTAAGTTGG + Intergenic
1086072360 11:82813268-82813290 CCAAGCAATGGGGAAGAGTTTGG + Intergenic
1086455668 11:86956299-86956321 CTGTGCACTGGGGACGAGGAAGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1088504159 11:110512941-110512963 CTGTGCAATGGCGAGGATGTGGG - Intergenic
1088610281 11:111570017-111570039 CCGGGCAAAGTGGAGGAGGTAGG - Intergenic
1089257429 11:117201206-117201228 CTGAGCACTGGGGATGAGGTGGG - Intronic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1089491909 11:118889146-118889168 GTGAGCACTGGGGAGGAGCAGGG - Intronic
1090468300 11:126955363-126955385 CCTAACAAAGGGGAGGAGGTTGG + Intronic
1090872642 11:130761967-130761989 GTGAGCAGTGGGGGTGAGGTGGG - Intergenic
1091446238 12:545701-545723 GTGAGGAATGGGGAGGAGCGAGG + Intronic
1091446331 12:546020-546042 GTGAGGAATGGGGAGGAGTGAGG + Intronic
1091775379 12:3181560-3181582 CTGTGCAGAGGGGAGGAGATTGG + Intronic
1091825169 12:3506856-3506878 CTGAGGCATGGATAGGAGGTAGG + Intronic
1092448258 12:8578318-8578340 CTGAGTCCTGGGGACGAGGTAGG - Intergenic
1092531947 12:9352221-9352243 CTGAGAAATGGGGACGAGAGGGG - Intergenic
1092648317 12:10604137-10604159 CTCATGAATGGGGAAGAGGTGGG + Intergenic
1092728495 12:11507297-11507319 CTGAGCAAAGTGGGGGAGGGTGG - Intergenic
1092894538 12:13000032-13000054 CTAAGCAAAGGGGACAAGGTAGG - Exonic
1092992257 12:13914212-13914234 GGGAGGAGTGGGGAGGAGGTAGG - Intronic
1096160265 12:49370781-49370803 CTGGGCAGGTGGGAGGAGGTTGG - Intronic
1096229861 12:49890813-49890835 CTGAGGAGTGTGGAGGGGGTTGG - Intronic
1096530473 12:52239528-52239550 CTAAGGATTCGGGAGGAGGTGGG + Intronic
1096747297 12:53737415-53737437 TTGAGGAATGAGGAGGAGCTGGG + Intergenic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1096887524 12:54732512-54732534 CTGAGGATTGGGGATGATGTGGG - Intergenic
1097697735 12:62790691-62790713 GAGAGCCACGGGGAGGAGGTAGG + Intronic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099751391 12:86778548-86778570 CTTAGCAGTGGTGAGGATGTTGG - Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101381821 12:104220109-104220131 CTTAGCAATGGGGCTGAGGCTGG + Intronic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1102173346 12:110858810-110858832 CAGAGCAAAGGGGAGGAGTTGGG + Intronic
1102432836 12:112897007-112897029 TGGAGCAATGGGGATGGGGTTGG + Exonic
1103613460 12:122137890-122137912 CTGTGCTGTGGGGAGGAGGCAGG + Intronic
1103879817 12:124157435-124157457 CCGAGCAACTGGGAGGAGATGGG + Intronic
1104498122 12:129259863-129259885 TTGAGCAATGGGGCTGAGGTTGG + Intronic
1104591061 12:130084968-130084990 TTGAGCAAGGGAGAGGAGCTTGG + Intergenic
1105313825 13:19237893-19237915 CTGGGAAGTGGGGAGGGGGTTGG + Intergenic
1106456159 13:29929190-29929212 ATGGGAAATGGGGAGGAGGGAGG + Intergenic
1108420859 13:50248153-50248175 GTGAGCAAGGGGGAAGAGGGTGG - Intronic
1108578212 13:51807220-51807242 CTGCGGAGTGGGGAGGAGGGTGG - Intergenic
1108613234 13:52104848-52104870 TTGAGCAATTTGGAGGAGGCAGG + Intronic
1111071803 13:83178744-83178766 CTGAGCAACAGGGGGCAGGTGGG - Intergenic
1112104091 13:96221515-96221537 CAGTGGGATGGGGAGGAGGTAGG + Intronic
1112609932 13:100946164-100946186 CTGAGCAAGGTGGATGTGGTAGG - Intergenic
1113791575 13:113031603-113031625 CTGGGAGATGGGGAGGAGGGCGG + Intronic
1113866412 13:113528568-113528590 CTGTGAATTGGGGAGGACGTGGG + Intronic
1113931917 13:113973093-113973115 CTGAGCTAAGGGGAGGAGTAAGG + Intergenic
1115331315 14:32201621-32201643 CTGAGAGCTGGGGAGGCGGTTGG - Intergenic
1115479357 14:33846132-33846154 GTGAGGAATGGGGGGGAGTTGGG - Intergenic
1115912785 14:38275019-38275041 ATGTGCATTCGGGAGGAGGTGGG + Intergenic
1116809223 14:49523468-49523490 CTGGGCAGTGGGGAGGAGTAGGG - Intergenic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117077169 14:52116367-52116389 TTGAACAAAGGGGAGGGGGTGGG - Intergenic
1117181636 14:53197878-53197900 AGGGGAAATGGGGAGGAGGTAGG - Intergenic
1117372782 14:55094061-55094083 CTGAGCAAGGGAGCGGAAGTGGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117733525 14:58747197-58747219 ATGAGCAGTGGGGAGGTCGTGGG + Intergenic
1117897433 14:60502253-60502275 CTCAGCAATGGGGAATAGGAAGG + Intronic
1118681438 14:68245782-68245804 CGGAGCAATGAGGTGGAGGTAGG + Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1118901060 14:69986244-69986266 GTGAGGAATGGGGTGGAGGAGGG + Intronic
1119182146 14:72612534-72612556 CTAAGGAGTGGGGTGGAGGTGGG - Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119894184 14:78205993-78206015 TTGAGCAATTGGGAGGTTGTGGG + Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121144716 14:91574003-91574025 CTGGGCAGGGAGGAGGAGGTTGG + Intergenic
1122214560 14:100194234-100194256 CTTGGCAATGTGGTGGAGGTGGG - Intergenic
1123778404 15:23602690-23602712 CTGAGGAATGGGGAAGACGCAGG - Intronic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124889604 15:33720378-33720400 CAGAGGAATGGGGATGGGGTGGG - Intronic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125885333 15:43225390-43225412 GAGAGCAATGGGGAGGTTGTGGG + Intergenic
1126411111 15:48374104-48374126 GGGAGAAATGGGGAGGAGGAGGG - Intergenic
1126725073 15:51623105-51623127 CTGCGGACTGGGGCGGAGGTGGG + Intergenic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127085785 15:55423456-55423478 CCCAGCACTTGGGAGGAGGTGGG - Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128637069 15:69309430-69309452 TTGAGGAATGGGCAGCAGGTGGG + Intronic
1129039906 15:72676800-72676822 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1129318668 15:74761797-74761819 CAGTGCAATGGGGCGGAGGGGGG + Intergenic
1129352216 15:74962731-74962753 CTGAGCCATGGTGAGGAGGTTGG - Intronic
1129430561 15:75498379-75498401 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1130121772 15:81056127-81056149 CTGAGGATTGGGGAAGGGGTTGG - Intronic
1130230741 15:82094893-82094915 ATGAGCAAGGGAGGGGAGGTGGG + Intergenic
1130597750 15:85258682-85258704 CTGAGCACTGGGGGGGAGCAGGG + Intergenic
1130602484 15:85285828-85285850 TTCAGCAATGGGGAGGAAGTCGG + Intergenic
1131741362 15:95396407-95396429 CTGAACAATGGGGCAGTGGTAGG + Intergenic
1132025157 15:98399063-98399085 CTGAGAAATAGGGAGGATCTTGG + Intergenic
1132353687 15:101156164-101156186 ATCAGCAGGGGGGAGGAGGTGGG + Intergenic
1132567710 16:630928-630950 CAGGGCAGAGGGGAGGAGGTTGG - Exonic
1132819731 16:1858463-1858485 CCGAGCAGTGGGGAGGAGGTGGG - Intronic
1133939578 16:10297159-10297181 CTGAGCGATGAGAAGTAGGTGGG + Intergenic
1134097889 16:11431145-11431167 CTGAGGAATGGAGGGGAGGCCGG - Exonic
1134133590 16:11665991-11666013 CTGAGAAATGGAGATGAGGCCGG - Intergenic
1136535900 16:30899361-30899383 GTGATCAATGAGCAGGAGGTTGG + Intronic
1137346473 16:47666495-47666517 CTGGTGAATGGGGAGGAGCTGGG - Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1138446408 16:57066919-57066941 CTGAGGGATGAGGAGGAGTTAGG - Intronic
1138567168 16:57841901-57841923 TTGAGAAGAGGGGAGGAGGTGGG - Intronic
1139321367 16:66117156-66117178 CCCAGCAATAAGGAGGAGGTAGG + Intergenic
1139363616 16:66419278-66419300 AGGAGGAATGGGGAGGAGGAGGG + Intergenic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1139576657 16:67846602-67846624 CTGTGCACTGGGGTGGGGGTTGG - Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140723173 16:77788958-77788980 CTGGGCGCTGGGGAGGGGGTGGG + Intronic
1140820835 16:78661639-78661661 CTGAGAGGTGGGGAGGGGGTGGG + Intronic
1141410346 16:83828803-83828825 CTGAGGAGTGGGGAGGATGGTGG - Intergenic
1141574552 16:84955598-84955620 CTGGGCACTGGGGATCAGGTCGG + Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141928296 16:87183700-87183722 CTGAGCCTTGGGGTGGGGGTGGG + Intronic
1142155952 16:88532977-88532999 CTGAGCAGTGGGAAGGGAGTGGG + Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1143730016 17:8876114-8876136 CTGAGGAAAGGGGCCGAGGTAGG - Intergenic
1143749336 17:9016984-9017006 CTGAGGATGGGGGAGGAGCTGGG - Intergenic
1143876497 17:9995060-9995082 CTGAGCACTGGGGAGCAGCAGGG + Intronic
1144754384 17:17670380-17670402 TTTAGGTATGGGGAGGAGGTGGG + Intergenic
1144861077 17:18302567-18302589 CTGAGGATTGGTGAGGAGCTAGG - Exonic
1144960653 17:19042334-19042356 CTGAGCCTTGGGGTGAAGGTCGG + Intronic
1144974507 17:19132190-19132212 CTGAGCCTTGGGGTGAAGGTCGG - Intronic
1144994057 17:19254724-19254746 CTGAGCACTGGAATGGAGGTGGG + Intronic
1146762569 17:35491149-35491171 CTGAGCCTCGGGGAGGAGGAAGG + Intronic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1147353195 17:39868259-39868281 CTCCGCACTGTGGAGGAGGTGGG + Exonic
1147698742 17:42377841-42377863 CTGAGTAATGGGAATGAGATTGG - Intronic
1147947209 17:44086857-44086879 GGGAGCAAGTGGGAGGAGGTGGG - Intronic
1148720259 17:49747439-49747461 CTGGGCTATGGGGAGGAAGTTGG + Intronic
1148795066 17:50192951-50192973 GGCAGCAATGGGAAGGAGGTAGG + Intronic
1148805650 17:50262571-50262593 GTGAGGAAAGGGGTGGAGGTGGG + Intergenic
1148874750 17:50680331-50680353 CTGGGCAAAGGAGTGGAGGTGGG + Intronic
1150146422 17:62773416-62773438 CTGAGGAGTGAGTAGGAGGTGGG + Intronic
1151563706 17:74885123-74885145 CTGCACAGTGAGGAGGAGGTGGG - Intronic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1151671052 17:75571880-75571902 CTTGGCTAGGGGGAGGAGGTGGG - Exonic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1152069321 17:78127180-78127202 CTGGGAAATGGGGAAGAGGTAGG + Intronic
1152241593 17:79164025-79164047 CTGAGCTGTGGGGTGGAGGTGGG - Intronic
1153678297 18:7475895-7475917 CTGAGCACTGGGAATGAGCTTGG - Intergenic
1153911598 18:9709729-9709751 CTGAGCAAGTCGGGGGAGGTGGG - Intronic
1154504643 18:15023656-15023678 CTGAATTATGGAGAGGAGGTGGG - Intergenic
1156465140 18:37343964-37343986 CTGAAAAATGGGGAGGAGTTTGG - Intronic
1156484048 18:37453621-37453643 AGGAGCAATGGCAAGGAGGTGGG + Intronic
1156744135 18:40368865-40368887 CTGAGAACTGGGGATGAGGGTGG - Intergenic
1156756723 18:40536732-40536754 CTGAGCCATGGCCAGGAGGAAGG - Intergenic
1157314250 18:46575127-46575149 CTGAGGGGTGGGGACGAGGTTGG - Intronic
1157439324 18:47697875-47697897 CTGGGCAATGGAGAGGGGATAGG - Intergenic
1158007456 18:52689146-52689168 CTAAGCACTGGGGAGGAGCTTGG + Intronic
1158269897 18:55701422-55701444 GGGGGCACTGGGGAGGAGGTGGG - Intergenic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1159086845 18:63802242-63802264 CAGTGCAATGGGGAGACGGTGGG + Intronic
1159815194 18:73065240-73065262 TGCAGCAATGTGGAGGAGGTGGG + Intergenic
1159952085 18:74492033-74492055 CTGAGCAATGGCCAAGAGGATGG + Intergenic
1160801870 19:974107-974129 CAAGGCAATGGGGAGGTGGTTGG - Exonic
1161171193 19:2813223-2813245 CTGAGCAAGGGGCTGCAGGTCGG + Exonic
1161200920 19:3014386-3014408 CTGTGCAGTGGAGAGGAGGTCGG + Intronic
1161284007 19:3459617-3459639 CCCAGCAATGGGGCGGGGGTGGG - Intronic
1161301150 19:3543776-3543798 CTGGCCAACGGCGAGGAGGTGGG + Intronic
1161796872 19:6392370-6392392 CTCAGCCTTGGGGAGGAGGGAGG + Intronic
1161957949 19:7506691-7506713 CAGAGAAAGGGGGAGGAGCTTGG - Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1161994491 19:7703929-7703951 CTGAGCATTGGAGAGGTGGCTGG - Intergenic
1162080463 19:8214885-8214907 AAGGGCAGTGGGGAGGAGGTGGG + Intronic
1162459837 19:10808206-10808228 CTGCCCAATGGGGAGAAGGGAGG - Intronic
1162503275 19:11066840-11066862 CTAAGCAATGGCGGGCAGGTCGG + Intergenic
1162809283 19:13154461-13154483 CTGGGCAGTGGGGAGGAGAGTGG + Exonic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1163772090 19:19197440-19197462 CTGCCAAATGGGGACGAGGTGGG - Intronic
1163785791 19:19274291-19274313 CTGAGCAGTGGAAAGGAGGTCGG + Intergenic
1164443466 19:28297980-28298002 CAGGGCAATGGGGAGGGGGGAGG - Intergenic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1164611871 19:29637826-29637848 CTGAGCACTGGGGAGAATTTGGG + Intergenic
1164622680 19:29706564-29706586 CTGAGCACTGAGATGGAGGTGGG + Intronic
1164778869 19:30876396-30876418 CAGAGCAGTGGGGAGGAGTGAGG + Intergenic
1165374488 19:35432141-35432163 CTGGGGAAAGGAGAGGAGGTGGG + Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166416604 19:42599855-42599877 CTGAGCACTGGGCAGGGGTTTGG + Intronic
1166579627 19:43883239-43883261 TTGAACTATGGGGAAGAGGTTGG - Intronic
1166870278 19:45866548-45866570 CTGACCCAAGGGGAAGAGGTGGG - Intronic
1166877908 19:45909073-45909095 CTGAGCAAACGGGAGAGGGTGGG + Intergenic
1166965968 19:46529471-46529493 CTTAACACTGGGGAGAAGGTGGG - Intronic
1167080531 19:47274124-47274146 CTGACCGTTGGGGAGGAGCTGGG + Intergenic
1167112010 19:47468170-47468192 CTGGGCAAGGGGGAGAGGGTGGG - Intronic
1167213703 19:48149912-48149934 CTGAGCACTGGGGTGGTGCTGGG - Intronic
1167460071 19:49620483-49620505 CTGAGGCCTGGGGAGGAGGGGGG + Intronic
1167736087 19:51295344-51295366 CTGACCTGTGGGGAGGGGGTGGG - Intergenic
1167842256 19:52131629-52131651 GTGAGCTAAGGGGAGGAGGTTGG + Intronic
1167852336 19:52211681-52211703 GTGAGCAAGGGGGCAGAGGTGGG - Intronic
1167959522 19:53095042-53095064 CTGGGCAGTGGGGAAGGGGTGGG - Intronic
1167959570 19:53095163-53095185 CTGGGCAGTGGGGAGGGGGCGGG - Intronic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168069632 19:53942426-53942448 CGGAGCCATTGGGAGGAGGGCGG - Exonic
1168265268 19:55220073-55220095 CTGAGCAGTGGGGGTGGGGTTGG - Intergenic
1168316842 19:55488342-55488364 CTGAGGCATGGGGGGGAGGGGGG - Intergenic
925254878 2:2474901-2474923 CTGAGCATGGGGGTGGGGGTGGG - Intergenic
925258062 2:2506805-2506827 CTGAGAAAAGGAGAGAAGGTGGG + Intergenic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
925545376 2:5010121-5010143 TTTAGCAATGCGGAAGAGGTTGG - Intergenic
926141748 2:10372215-10372237 CTGAGCCATGGCGAGGAAGCTGG + Intronic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926385815 2:12334750-12334772 TGGTGAAATGGGGAGGAGGTAGG + Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926425942 2:12738698-12738720 CTGAGCTAAGGAGAGGAGGCTGG + Intronic
926643742 2:15265882-15265904 CAAAGCACTGGAGAGGAGGTAGG + Intronic
926982198 2:18584434-18584456 CTGCGCAGTGGAGAGGAGGGCGG + Intronic
927499765 2:23574943-23574965 CTGAGGAATGGGTGGGAGGGTGG + Intronic
927561527 2:24077052-24077074 CTGAGGAAAGTGGTGGAGGTGGG + Intronic
928800779 2:35088694-35088716 CTGAGTAATGGGGAAGAGAAGGG + Intergenic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
929608454 2:43251770-43251792 ATGAGGATAGGGGAGGAGGTAGG - Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930392040 2:50773633-50773655 CTGAGCAAAGGTGAAGAGATTGG - Intronic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930874183 2:56194861-56194883 CACAGCAATGGGGTGGGGGTGGG - Intronic
931384590 2:61786630-61786652 CTGAGCAAAGGCATGGAGGTGGG + Intergenic
931938729 2:67228657-67228679 CTTTGCAGTGGGGAGGAGCTTGG - Intergenic
932864402 2:75326365-75326387 CTGAGCAATGATGGTGAGGTTGG - Intergenic
933446656 2:82388217-82388239 GTGAGGAGTGGGGATGAGGTGGG + Intergenic
933727597 2:85435558-85435580 CCGAGCAGTGGGGAGCAGGAGGG + Intronic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934995342 2:98952718-98952740 CTGAGTCATGTGGAGGAGGCTGG - Intergenic
935127219 2:100235264-100235286 CTGAGCAGCGGGGAGGCTGTGGG - Intergenic
935359662 2:102236751-102236773 CAGAGCAATGGGGAGGCAATGGG - Intronic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937950019 2:127377513-127377535 ATGAGCAATGTGGAGGCAGTGGG + Intronic
938140940 2:128794164-128794186 ATGAGGACTGGGGAGGTGGTTGG - Intergenic
941080463 2:161054913-161054935 CTGAGGAAAGGGGAGGTGATGGG + Intergenic
941357218 2:164509221-164509243 CTCAACAAAGGGGAGAAGGTTGG + Intronic
942249433 2:174034748-174034770 CACAGCAATGGGGTGCAGGTTGG + Intergenic
942458603 2:176154013-176154035 CTGTGCAGTGGGGAGAAAGTGGG + Intronic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944098264 2:195994317-195994339 CTGAGCCTTGGGGAGGAGGAAGG - Intronic
944207112 2:197168639-197168661 CTGAGCAATAGGGAGAAGAAGGG - Intronic
944282057 2:197909518-197909540 CAGAGCCATGAGGAGGAAGTGGG - Intronic
944822593 2:203445652-203445674 CTGAGCAAGGAGGCTGAGGTGGG + Exonic
945417880 2:209597804-209597826 GTAAGCAAAGGGGAGGAGGGTGG - Intronic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
946064135 2:216971891-216971913 CTGAGCAAAAGAGAGGAGATAGG + Intergenic
946171054 2:217895797-217895819 CTAGGCAGTGGGGTGGAGGTGGG - Intronic
946462738 2:219884023-219884045 CAGAGACATGGGGAGGTGGTGGG + Intergenic
946709974 2:222495655-222495677 CTGAGCCACAGGGAGAAGGTGGG - Intronic
947045084 2:225972823-225972845 CTGAGCACTGGGGAGAAATTTGG - Intergenic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947379991 2:229536193-229536215 CTGAGGAAGGCTGAGGAGGTTGG + Intronic
947848112 2:233262099-233262121 CTGAGCAACTGGTAGAAGGTAGG - Intronic
948033873 2:234841916-234841938 CTCAGAAATGGGGAGGAATTGGG + Intergenic
948051531 2:234982704-234982726 GTGGGCAAATGGGAGGAGGTGGG + Intronic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948888630 2:240896426-240896448 CTGGGCTGTGGGGAGGAGGGTGG - Intronic
949067486 2:242002066-242002088 CTGAGCATTGGTGAGGGGCTTGG - Intergenic
1169087530 20:2836595-2836617 CTGGTCTATGGGGAGGAGGTGGG - Intronic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169128414 20:3148115-3148137 TTGATCAATTTGGAGGAGGTTGG - Exonic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1170034753 20:11978721-11978743 CTCAGGAATGGAGAGGATGTGGG - Intergenic
1171361425 20:24588952-24588974 CTGAGCTGTGGGGTGGGGGTGGG + Intronic
1171370697 20:24660519-24660541 CTGACGAGTGGGGAGGAGGAGGG - Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172407730 20:34702070-34702092 TTGAGCAAAAGGGTGGAGGTGGG + Intronic
1172428071 20:34869539-34869561 CTGGGCAAGAGGGAGGAGGCAGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1172889114 20:38251489-38251511 CTGGGCAATGGAGTGGGGGTGGG + Intronic
1173107187 20:40148777-40148799 CTGAGAAATGGAGAGGGGTTAGG + Intergenic
1173199720 20:40945592-40945614 CTAGGCACTGGGGAGGTGGTTGG - Intergenic
1173246975 20:41343634-41343656 CTGAGAAATGCTGTGGAGGTGGG + Intronic
1173863499 20:46299228-46299250 ATGAGCAAAGAGGAGGAGCTTGG - Intronic
1173885698 20:46457283-46457305 CTGAGCAATGTGGTGGAGCTGGG + Intergenic
1174007496 20:47422085-47422107 ATTAGAAATGGGGAGGAGATGGG - Intergenic
1174299653 20:49572269-49572291 ATGAGCAAAGGTGTGGAGGTGGG - Intergenic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1174525598 20:51168138-51168160 CTGAGCACTGGGGGTGAGGCTGG - Intergenic
1174672922 20:52324692-52324714 CTGAGCGTGGGGGAGGAGGTAGG - Intergenic
1174852319 20:54007127-54007149 ATGAGCACTGGGGAGCACGTGGG - Intronic
1177055571 21:16297351-16297373 CTGAGCAATTGGGTGGATGAGGG - Intergenic
1177162515 21:17563418-17563440 GTGAGAGATGGGGAGGATGTTGG + Intronic
1177491329 21:21829678-21829700 CTGATCCATGGGGGTGAGGTGGG + Intergenic
1179456483 21:41504505-41504527 CTGAGCAATGGTCAGGAGAGAGG - Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1180902933 22:19387706-19387728 CTGAGCGAGGAGGAGAAGGTAGG - Exonic
1181048901 22:20229504-20229526 CTGAGGCATGGGGAGGTGATGGG + Intergenic
1181266075 22:21631758-21631780 CTGAGCAAAGGGGAAAAGGAGGG + Intergenic
1181573135 22:23778663-23778685 CTCCACACTGGGGAGGAGGTGGG + Intronic
1182317745 22:29459148-29459170 CTGGGCAACAGGGTGGAGGTGGG + Intergenic
1182376192 22:29850044-29850066 CTAAGCACTGGGGATAAGGTTGG - Intergenic
1182747116 22:32614541-32614563 CTGACCAGTGGTGGGGAGGTGGG + Intronic
1183090365 22:35518257-35518279 CTGAGCAAAGGCTGGGAGGTAGG + Intergenic
1183565657 22:38612672-38612694 ATGAGCAATGGGGAGGAAATGGG + Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184189910 22:42887638-42887660 CTGACCAAAGGAGGGGAGGTGGG + Intronic
1184468731 22:44683747-44683769 ATGAGCCATGGGGAGGAGAGAGG - Intronic
1184514374 22:44952968-44952990 CTGCGGAATGGGGAGGAGCTAGG - Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1185052178 22:48559678-48559700 CTGAGCCTTGAGGAGGAGGAAGG + Intronic
949241707 3:1880512-1880534 ATGAGGAGTGGGGAGGAGGGTGG - Intergenic
949698440 3:6727231-6727253 TTGAGCATTGGTGAGCAGGTAGG + Intergenic
950551127 3:13666448-13666470 CTGAGAAATGGTGAGTGGGTGGG + Intergenic
950653846 3:14424523-14424545 CTGGGCAATGGGGAGGGGAGAGG + Intronic
950772732 3:15325025-15325047 CTGAGCAATGAGGAAAAGGACGG + Intronic
950964145 3:17134442-17134464 CTGACAAATGGAGAGGAGGAAGG - Intergenic
952844270 3:37673831-37673853 TTGCAAAATGGGGAGGAGGTTGG + Intronic
952945721 3:38477020-38477042 CTAAGCAAAAGGGAGGAGGCAGG - Intronic
953371057 3:42388880-42388902 GTGAGTTGTGGGGAGGAGGTAGG + Intergenic
953580689 3:44152944-44152966 TTGACCAATGGCGGGGAGGTTGG + Intergenic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955153898 3:56396797-56396819 CTGAAGCATGGGGAGGAGGGTGG + Intronic
955574259 3:60342094-60342116 CTGTGCAGTGGGGAGGAGCCTGG - Intronic
957136979 3:76300945-76300967 CTAAGCAATGGGAAGGAGATGGG + Intronic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958119416 3:89264454-89264476 CTGAGCAAGGGGTACGAGGGAGG - Intronic
958921831 3:100115216-100115238 TTGAGCACTGGGCAGGTGGTAGG - Intronic
959527327 3:107391733-107391755 CTGAGAAAGTGGGAGGAGATGGG - Intergenic
960189370 3:114684794-114684816 CTCACAAATGGGGAGGTGGTAGG + Intronic
960556741 3:119038408-119038430 TTGGGCTATGGGGAGGAGGATGG - Intronic
961386678 3:126526791-126526813 CTGGGCACTGGGGATGAGGGTGG - Intronic
962306777 3:134294441-134294463 GTGGTCAATGGGGAGGATGTGGG + Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963828072 3:149977051-149977073 CTGAGCATTGTGGAGCAGGAGGG + Intronic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966027883 3:175308408-175308430 CAAAGCAATGGAAAGGAGGTAGG + Intronic
966934135 3:184694771-184694793 CTTAGAAATGGGGCGGAGGAGGG - Intergenic
968047454 3:195632054-195632076 CTGACCCAGGGGCAGGAGGTGGG + Intergenic
968292713 3:197551195-197551217 CTGTGCAGTGGGGAGAAGATGGG - Intronic
968307159 3:197657870-197657892 CTGACCCAGGGGCAGGAGGTGGG - Intergenic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968873608 4:3253917-3253939 CTCAGCACTGGGGAGGGTGTCGG + Intronic
969044065 4:4323818-4323840 TTTAGCAATGGGGAGGTCGTGGG - Intergenic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969258716 4:6020718-6020740 CTGAGCTCTGGGGCGGTGGTGGG + Intergenic
969460248 4:7325173-7325195 CAGGGCACTGGGGAGTAGGTGGG + Intronic
969486199 4:7473736-7473758 CTTGGCAATGGGGAGGTGGGAGG + Intronic
970248917 4:14093646-14093668 CTGAGAAATGGGGATGATGAAGG + Intergenic
971447447 4:26766022-26766044 CTGACCCATGGTGGGGAGGTGGG + Intergenic
973833499 4:54786015-54786037 CTGAGCTGGGGGGAGTAGGTTGG - Intergenic
975355869 4:73403203-73403225 CTGAGCAAAAGGGCAGAGGTAGG + Intronic
975912686 4:79286347-79286369 TTGAGCAATGAGGATGAGGTGGG + Intronic
976612512 4:87044640-87044662 CTGAGGAATGGGGAGTAGTCAGG + Intronic
976745904 4:88402758-88402780 CTGTGCATTTGGGAGGAGCTAGG + Intronic
977294075 4:95192397-95192419 GTGAGAAGGGGGGAGGAGGTGGG - Intronic
979618960 4:122776448-122776470 CTGAGGAACTGGGAGGAGGTGGG + Intergenic
985009738 4:185570130-185570152 CTGGGCAGTGGGGGAGAGGTGGG + Intergenic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986961037 5:13213100-13213122 CTGACCACTGGGGATGAGCTGGG + Intergenic
987483422 5:18490748-18490770 GTGAGCAATGGGACGGAAGTCGG + Intergenic
987525834 5:19047790-19047812 CTGAGCAAAGGAAAGGAGCTAGG - Intergenic
988059457 5:26148679-26148701 CCCAGCAGTGGGGAGGGGGTGGG + Intergenic
988703591 5:33701049-33701071 CTGAGGAATGGAGATGAGGGAGG + Intronic
989432653 5:41373722-41373744 ATTAGCACTGGGGAGGAAGTTGG + Intronic
990180053 5:53150880-53150902 CTGAGCAAATGGGAGAAGGGTGG - Intergenic
991240098 5:64448551-64448573 CAAAGGAATGGGGAGGAGGAAGG - Intergenic
992267255 5:75031644-75031666 CTGAGGAATGGGGCCTAGGTAGG + Intergenic
993715579 5:91272733-91272755 CTAAACAATGGGGACTAGGTGGG + Intergenic
994167860 5:96626566-96626588 CTGAGAAGATGGGAGGAGGTGGG - Intronic
994505886 5:100642221-100642243 CTTTGCAGTGGGGAGGAGATGGG + Intergenic
996965175 5:129299575-129299597 CTGAGCAATGGAGAAAAGTTTGG - Intergenic
997476969 5:134148468-134148490 ATGAGCACTGGGGAGCAGGCTGG - Intronic
998141082 5:139699916-139699938 CTTAGCATTGGGGAGAAAGTGGG + Intergenic
998537210 5:142944931-142944953 CTGAGCAATGGGGTTGGGGAGGG - Intronic
999977938 5:156930347-156930369 TTGAGCAATGTGATGGAGGTTGG + Intronic
1000254078 5:159521257-159521279 CTGAGCAGTGGAGAGCAGTTAGG + Intergenic
1000280777 5:159780123-159780145 CTGGGCCATGGAGAGGAGGCAGG - Intergenic
1000648981 5:163792401-163792423 CTGAGCATTGGGTATTAGGTAGG + Intergenic
1000934615 5:167292876-167292898 TTGAGGGATGGGGAGGAGGTTGG + Intronic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG + Intronic
1001600138 5:172923240-172923262 CTGAGCATCTGGGAGGAGGGAGG + Intronic
1002101158 5:176858324-176858346 CTGAGCCCTGGAGAGAAGGTAGG + Intronic
1002700926 5:181124406-181124428 TTGAGGAATGGGGAGGTGATGGG - Exonic
1003014206 6:2454913-2454935 CTGAGCAGGGGGCAGAAGGTGGG - Intergenic
1003294435 6:4811893-4811915 CTGATGAATGGGGAAGAGGGTGG - Intronic
1004145314 6:13060532-13060554 CTGAGAAGTGAGGAGTAGGTGGG + Intronic
1004376385 6:15094185-15094207 CTGAGAAATGGGGATGGGGGAGG + Intergenic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1004934050 6:20490338-20490360 CTGAGCCTCGGGGAGGAGGAAGG + Exonic
1005001183 6:21243582-21243604 CTGAGAAATGGGGAAGAGCTTGG + Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005362127 6:25040918-25040940 ATGAGGAATGGGGTAGAGGTTGG - Intronic
1005763175 6:28986344-28986366 CTGAGGAATGGGGTGGGGGTAGG - Intergenic
1005841681 6:29748172-29748194 CTGAGGGCAGGGGAGGAGGTGGG + Intergenic
1006305014 6:33213564-33213586 CTGAGCATGGGGGAGGAATTTGG - Intergenic
1006364159 6:33605323-33605345 CTGAATAATGGGGTAGAGGTTGG - Intergenic
1006929410 6:37678679-37678701 CCAAGCAGTGGGGAGGGGGTGGG - Intronic
1007094388 6:39204437-39204459 ATGTGCTATGGAGAGGAGGTAGG - Intronic
1007161292 6:39793346-39793368 CTGAGCTGTGGGGTGGAGGAAGG + Intronic
1007370135 6:41421362-41421384 CTGAGCAATCGGCTGGAAGTGGG + Intergenic
1007933443 6:45712749-45712771 TTGAGTAATGGGTAGGGGGTGGG + Intergenic
1011970207 6:93212806-93212828 TTGAGAAAAGGGCAGGAGGTAGG + Intergenic
1013401098 6:109797011-109797033 CTGAGGGATAGGGAAGAGGTTGG + Intronic
1014194846 6:118543074-118543096 ATGAGCTAAGTGGAGGAGGTGGG - Intronic
1016235313 6:141857008-141857030 TTGAGCAAAGGGGAGGGGTTTGG - Intergenic
1016330303 6:142946732-142946754 CTGGGAAATGGGGAAGGGGTGGG - Intergenic
1017081335 6:150671822-150671844 GTGAGCAGTGGGGATGGGGTTGG + Intronic
1017234336 6:152103881-152103903 CTGATGAATTGGGAGGGGGTGGG + Intronic
1017277843 6:152590716-152590738 ATAAGCAATGGAGTGGAGGTGGG - Intronic
1017981514 6:159404474-159404496 CAGAGGCATGGGGTGGAGGTGGG + Intergenic
1018160803 6:161040875-161040897 TTGATCAATGGGGAGAAAGTGGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1019127546 6:169850940-169850962 CCTGGCAATGGGGAGGAGGCCGG + Intergenic
1019292840 7:258736-258758 CTGCGCAGTAGGGAGGAGGGTGG - Intronic
1019522239 7:1466237-1466259 TTGAGCGGTGGGGAGGAGTTGGG - Intergenic
1019784513 7:2966761-2966783 ATGTGACATGGGGAGGAGGTAGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021085771 7:16420329-16420351 CTGAGTAATGAGGTGGAGCTTGG - Intronic
1021648344 7:22808352-22808374 CTGTGCAGTGGGGAGGAGCCTGG + Intergenic
1022357677 7:29631058-29631080 CTCAGCAAGGGAGAGGCGGTGGG + Intergenic
1022367996 7:29744016-29744038 CTCAGCAAGGGAGAGGCGGTGGG + Intergenic
1022389227 7:29928955-29928977 TGGAGCAGTGGGGAGGAGGAGGG + Intronic
1022515303 7:30971399-30971421 GTGAGCAAAGGGGCAGAGGTAGG - Intronic
1023119989 7:36899452-36899474 ATGAGCAAAGGCAAGGAGGTAGG + Intronic
1023203740 7:37725550-37725572 CTGAGCCTTGGGGATGAGGGAGG - Intronic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1023818337 7:43966547-43966569 CTGAGAAATGGGTGGGAGCTTGG - Intergenic
1023858014 7:44197204-44197226 TTGTGCAGTGGGGAGGGGGTGGG + Intronic
1024471224 7:49770322-49770344 CTGAGCAATGCAGAGCAAGTGGG - Intergenic
1024896497 7:54267475-54267497 CTGAGCAATGGTGAAAAGATAGG + Intergenic
1026502866 7:70957768-70957790 TTGAGCAATGTGGAGGAGAGAGG + Intergenic
1027187611 7:75981414-75981436 CTGAGCTTTGGGGATGGGGTGGG + Intronic
1027336642 7:77157923-77157945 CTGTGCTATGGGTAGGAGATAGG - Intronic
1028696497 7:93719347-93719369 CTTAGAAAAGGAGAGGAGGTGGG + Intronic
1029591846 7:101512170-101512192 GTCAGCACAGGGGAGGAGGTTGG + Intronic
1029779148 7:102713186-102713208 CTGTGCTATGGGTAGGAGATAGG + Intergenic
1029998295 7:105031354-105031376 CTGAGGATTGGGGGGGTGGTGGG + Intronic
1033628866 7:143138056-143138078 CTGAGCAAGCTGCAGGAGGTGGG + Intronic
1034266339 7:149782855-149782877 CTGGTCAATGGGCAGGATGTGGG + Intergenic
1034452617 7:151145303-151145325 GTGAGGAAAGGGGAGGAGGTAGG + Intergenic
1034557298 7:151858256-151858278 CTGAGTACTGGGGAGGAGAGGGG - Intronic
1035024041 7:155815046-155815068 CTGGGCCGTGGGGAGCAGGTGGG - Intergenic
1035047215 7:155975557-155975579 CTGAGGAGGGGTGAGGAGGTGGG + Intergenic
1035392506 7:158514600-158514622 GTGAGCACTGAGGAAGAGGTGGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036193762 8:6695738-6695760 TTGTTCAATGGGGAGAAGGTGGG + Intergenic
1037225170 8:16578833-16578855 TTGAGCAATAGATAGGAGGTAGG - Intergenic
1037780432 8:21864754-21864776 CAGAGCAGTGGGAAGAAGGTGGG + Intergenic
1037909191 8:22733673-22733695 CTGTGCAAATGGGAAGAGGTGGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038447253 8:27612707-27612729 CCGAGCAAAGGAAAGGAGGTCGG - Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038562066 8:28589272-28589294 CTCAGCCACGGGGAGCAGGTGGG + Intergenic
1040480245 8:47819043-47819065 CTGAGCAGTGGGGAAGAGGCAGG - Intronic
1040724600 8:50367930-50367952 CTGGGCAATAGGGTAGAGGTTGG + Intronic
1041847858 8:62352222-62352244 CTCAGCAATGGGAAGGAGTCAGG - Intronic
1043872258 8:85446611-85446633 CTGAGCACTGGTAAGGAGATGGG + Intronic
1044021742 8:87113206-87113228 GTGAGCCATGGGCAGTAGGTAGG + Intronic
1044972029 8:97629004-97629026 CTGAGCATTGGCCAGGAGATTGG + Intergenic
1045279266 8:100735669-100735691 GTGAGCCTTGGGGAGGAGTTTGG - Intergenic
1045779578 8:105847991-105848013 CTGACCCATGGGCAGCAGGTGGG - Intergenic
1047289523 8:123517152-123517174 CTCATCACTGGGTAGGAGGTGGG + Intronic
1047422955 8:124722300-124722322 CTGAGCAAATGGGAGGATTTGGG - Intronic
1048470539 8:134700522-134700544 CCGAGCACTGGGGTGGAGGGAGG - Intronic
1049117791 8:140704731-140704753 CAGAGCAATGGGAAGTACGTAGG - Intronic
1049157488 8:141075735-141075757 CTGTGCAATGGGGACGCGGGAGG - Intergenic
1049503305 8:142980020-142980042 CCGAGCATTGGGGAGGTTGTGGG - Intergenic
1049785544 8:144448995-144449017 CTGAGAAATGGAGAGGAACTGGG - Intergenic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1049994844 9:1025139-1025161 GTGAGCATTGTGGAGGAGGCAGG + Intergenic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1052626494 9:30982314-30982336 ATGAGCAGTGGGGAGTATGTGGG - Intergenic
1052844396 9:33322334-33322356 CTGAGCTGAGGGGAGGAGGAAGG - Intronic
1052889584 9:33685930-33685952 CTGAGCACTGGGAAAGGGGTGGG + Intergenic
1053101835 9:35377730-35377752 CTGGGCTATGGGGAGGAGACTGG + Intronic
1053416891 9:37952438-37952460 GTGAGCAGCGGGCAGGAGGTAGG + Intronic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1055686241 9:78777987-78778009 CTGCGCACTGGGGTGGAGCTTGG - Intergenic
1057745216 9:97745780-97745802 CAGAGGAATGGAGGGGAGGTTGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1059046886 9:110878653-110878675 CTGTGCCATGTGGAGGAGGCAGG - Intronic
1059819185 9:117952771-117952793 ATGTGCTTTGGGGAGGAGGTTGG + Intergenic
1060104321 9:120863971-120863993 CTGAGCAAAGGCTATGAGGTAGG + Intronic
1060231720 9:121830409-121830431 CTGTGCAGTGGGGAGCAGGGAGG - Intronic
1060289208 9:122284893-122284915 CTCAGCAATGAGGCTGAGGTGGG - Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1061332553 9:129905119-129905141 CTGAGAAATAGGGAGGTAGTGGG - Intronic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1061954674 9:133955513-133955535 GTGGGGAATGGGGAGGAGCTTGG - Intronic
1062178128 9:135175701-135175723 CTCAGCAATGGGGCTGAGGTGGG - Intergenic
1062403339 9:136382024-136382046 CTGACCCCTGGGGATGAGGTGGG + Exonic
1186229455 X:7437545-7437567 CTAAGCAAGATGGAGGAGGTAGG - Intergenic
1187141915 X:16602041-16602063 ATGAGCAATGGGGATGAGGGAGG + Intronic
1188006366 X:25018130-25018152 CTGCACAAGGGGGAGGAGGGGGG - Intergenic
1189584435 X:42443688-42443710 GGGAGCAATGGGATGGAGGTTGG - Intergenic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1190109910 X:47582961-47582983 TTGAGGAATTTGGAGGAGGTTGG - Intronic
1190414475 X:50167367-50167389 CTGAGGATTGGGGTGGGGGTAGG + Intergenic
1190449645 X:50565879-50565901 CTTAGTAATGGGGTGGAGGAAGG - Intergenic
1191984337 X:66962192-66962214 CTGGGCAGTGGGGTGGAGGAGGG + Intergenic
1192343388 X:70281904-70281926 CACAGCAAAGGGGTGGAGGTGGG - Intergenic
1192547532 X:72026469-72026491 CCCAGGCATGGGGAGGAGGTGGG + Intergenic
1193198065 X:78657377-78657399 TTGAGCAATGAGGTGGAAGTGGG + Exonic
1193743959 X:85252644-85252666 TTCAGAAATGGGGAGGAGGTGGG - Intronic
1196703695 X:118698389-118698411 CAGAGAAGTGGGTAGGAGGTGGG - Intergenic
1197012889 X:121588575-121588597 CTGAGCAAAGGAGAGGTGATGGG + Intergenic
1199991192 X:152988566-152988588 CTGGGCAAGGGGCAGCAGGTGGG - Intergenic
1201366867 Y:13216489-13216511 CAGAGAAAAGGGGAGAAGGTGGG + Intergenic