ID: 1083663116

View in Genome Browser
Species Human (GRCh38)
Location 11:64261240-64261262
Sequence AGGGCGCATCAGTGAGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083663108_1083663116 29 Left 1083663108 11:64261188-64261210 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1083663116 11:64261240-64261262 AGGGCGCATCAGTGAGACCCCGG 0: 1
1: 0
2: 1
3: 6
4: 124
1083663106_1083663116 30 Left 1083663106 11:64261187-64261209 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1083663116 11:64261240-64261262 AGGGCGCATCAGTGAGACCCCGG 0: 1
1: 0
2: 1
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083663116 Original CRISPR AGGGCGCATCAGTGAGACCC CGG Intronic
902504487 1:16930351-16930373 AGGGCGCAGCAGGGAGGGCCAGG + Intronic
904481437 1:30796328-30796350 AGGTGGCACAAGTGAGACCCTGG + Intergenic
908659802 1:66423916-66423938 AGGGCACATAAGTGATAGCCTGG + Intergenic
908799874 1:67868523-67868545 AGGGCTCATCAGTGATATCAGGG + Intergenic
910515351 1:88054236-88054258 AGTGAACATCAGTGATACCCAGG - Intergenic
913527939 1:119712046-119712068 AGTGCTCATCAGTGACAGCCTGG + Exonic
913663083 1:121021735-121021757 AGGGGGCAGCATTGACACCCAGG + Intergenic
914014466 1:143805000-143805022 AGGGGGCAGCATTGACACCCAGG + Intergenic
914311964 1:146474760-146474782 CGTGGGCAACAGTGAGACCCTGG - Intergenic
914653090 1:149713557-149713579 AGGGGGCAGCATTGACACCCAGG + Intergenic
917410194 1:174751430-174751452 AGGGCACATCAAATAGACCCTGG + Intronic
917856622 1:179106356-179106378 AGGGAGCACCAGGTAGACCCTGG - Exonic
917894948 1:179478536-179478558 AGGGCACAGCAGAGGGACCCTGG + Intronic
919645514 1:200090751-200090773 AGGGGGCATCAGTGAGACCAGGG + Intronic
920836189 1:209513255-209513277 ATGAGGCATCAGTGACACCCTGG - Intergenic
921185391 1:212665570-212665592 AGGCCGCATCAGGGAGCCCTAGG + Intergenic
1063225034 10:4007584-4007606 AGGGCGCAGCACTGACAACCGGG + Intergenic
1063909536 10:10815206-10815228 GGAGCACATCAGTGACACCCTGG - Intergenic
1070941908 10:80356137-80356159 TGGGCATATCAGTGGGACCCAGG + Intronic
1071727870 10:88218125-88218147 AGGTGGCATCAGTTAGCCCCAGG - Intergenic
1075286211 10:121188434-121188456 AGGGCCCATCAGAGAGCCCCAGG - Intergenic
1075336659 10:121613613-121613635 AGGGAGCATCAGGGAGGGCCAGG - Intergenic
1076369964 10:129946159-129946181 AGGGCCCAGCAGTGAGAAGCAGG - Intronic
1077499634 11:2903317-2903339 CAGGCGCAGCAGGGAGACCCAGG - Exonic
1079128004 11:17732399-17732421 AGGGGGCTGCAGTGTGACCCAGG - Intergenic
1079737818 11:24019197-24019219 AGGGCCCATATGTAAGACCCAGG + Intergenic
1081338008 11:41891316-41891338 AGAGCCCATGAGTGAAACCCGGG - Intergenic
1082006401 11:47421623-47421645 AGGGAGCAACAGGGAGGCCCAGG + Intronic
1082716523 11:56620490-56620512 AGGGAGCAGCAGTGAGACAGAGG + Intergenic
1083395430 11:62388340-62388362 AGGCAGCATCAGCGACACCCGGG + Intronic
1083663116 11:64261240-64261262 AGGGCGCATCAGTGAGACCCCGG + Intronic
1084014213 11:66369216-66369238 AGAGTGCATCAGTGGGGCCCAGG + Intronic
1084978306 11:72815100-72815122 AGGGGGCATCAGGGGGCCCCGGG + Intronic
1085520033 11:77132269-77132291 AGGGCTCATCAGGAAGCCCCAGG - Intronic
1087006889 11:93479905-93479927 AGGGGGCATGATGGAGACCCGGG + Intronic
1088093404 11:106070182-106070204 AGAGCTCATTAATGAGACCCTGG - Intronic
1091220169 11:133925991-133926013 ACAGCGCATCAGCGAGGCCCAGG + Intronic
1092249599 12:6885772-6885794 AGCTCCCCTCAGTGAGACCCTGG - Intronic
1101569188 12:105937359-105937381 GGGGCTCATCAGGGACACCCTGG + Intergenic
1101867301 12:108529725-108529747 AGGGAGCATCAGACACACCCAGG + Intronic
1104964284 12:132502076-132502098 GGGACGCATCACTCAGACCCGGG - Intronic
1107556095 13:41517805-41517827 AGTGGGCTTCAGAGAGACCCAGG - Intergenic
1113444213 13:110353004-110353026 AGGGGGCGTCAGTGAGAGCTGGG + Intronic
1114530738 14:23394157-23394179 CGGGCGCATCAAAGAGACGCTGG - Exonic
1115950189 14:38712594-38712616 TGGGGGCAACAGTGAAACCCTGG - Intergenic
1116645196 14:47519110-47519132 AGGGAGAATCACTTAGACCCGGG + Intronic
1119313890 14:73674873-73674895 TGGGCGACACAGTGAGACCCTGG - Intronic
1124201538 15:27682429-27682451 AGGCTGAATCACTGAGACCCTGG + Intergenic
1129599197 15:76988398-76988420 AAGGGGCCTCAGTGAGTCCCAGG - Intergenic
1130228780 15:82080697-82080719 GGGGCGCATCAGTGAGAAGTGGG + Intergenic
1135894088 16:26382832-26382854 ATGGGGCATCAGTGAGGCCTGGG + Intergenic
1141615623 16:85207935-85207957 AGGGCCCTTGAGTGAGCCCCTGG - Intergenic
1141870592 16:86782853-86782875 AGAGCCCATAGGTGAGACCCAGG - Intergenic
1143634562 17:8156906-8156928 AGGGAGCCTCGGTGGGACCCAGG - Intronic
1146724532 17:35146981-35147003 AGGGAGCCTCAGTGTGTCCCAGG + Intergenic
1150209499 17:63434394-63434416 CGGGCGCATCACTGGGAGCCGGG + Exonic
1160313426 18:77819224-77819246 AGAGCTCATCAGAGAGACCTGGG + Intergenic
1160370080 18:78364841-78364863 AGGACCCAGCAGTGAAACCCAGG - Intergenic
1160679409 19:405900-405922 AGGGCACATCTGTGGTACCCAGG - Exonic
1161297667 19:3527893-3527915 AGGGAGCATCAGTACGAGCCAGG + Intronic
1165147436 19:33740273-33740295 AGGGCTCTTCAGTGACGCCCAGG + Intronic
1165658303 19:37551897-37551919 AGGGCGCATAAGAGAGCCCGCGG - Intronic
1167891450 19:52543004-52543026 AGGGGGCATCAGTGCAGCCCAGG + Intronic
927211193 2:20640202-20640224 TGGGGGCATCTGTGAGACCAGGG + Intronic
929339705 2:40800223-40800245 AGAGCTCTTCAGTGAGACACTGG - Intergenic
929703258 2:44183615-44183637 AGGGCATACCAGTGAGCCCCAGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932738951 2:74277053-74277075 AGGGAGCATCACTGGGACACTGG - Intronic
934495030 2:94789152-94789174 AGGCCTCATCAGTGGGAACCTGG - Intergenic
934552814 2:95272533-95272555 AGGGAGAAGCAGTGAGGCCCTGG + Intergenic
942726880 2:179019412-179019434 AGGGTACAATAGTGAGACCCTGG - Intronic
943981595 2:194559621-194559643 AGAGGGCCTGAGTGAGACCCGGG - Intergenic
948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG + Intergenic
1175687923 20:61044903-61044925 AGTGCTCCTCAGTGAGAGCCTGG + Intergenic
1178959921 21:37056272-37056294 AGGGAGCAGCAGTGAGACCATGG + Intergenic
1180181331 21:46119874-46119896 TGGGCACCACAGTGAGACCCTGG - Intronic
1180668152 22:17531419-17531441 AGGGAGCATCAGAGGGACCACGG - Intronic
1182085456 22:27558180-27558202 AAGACGCATTTGTGAGACCCAGG - Intergenic
1182107668 22:27700841-27700863 AGGTCCCATCTGTAAGACCCTGG + Intergenic
1183055028 22:35299970-35299992 ACAGCGCATCGGTGAGTCCCTGG + Exonic
1183185986 22:36291901-36291923 AGGGCCCATCAGAGAAAGCCTGG - Intronic
1183227921 22:36563211-36563233 AGGGGGCATCAGTGAGTCCAAGG + Intergenic
949545152 3:5066268-5066290 AGGGAGTATCAGTGAAAGCCAGG + Intergenic
950156031 3:10722351-10722373 AAGGAGCATCTCTGAGACCCAGG + Intergenic
950443183 3:13021734-13021756 AGGGCACAGCTGTGTGACCCTGG - Intronic
952884610 3:38004578-38004600 AGGTGGCAGCAGTGAGACTCCGG + Intronic
953926668 3:46986055-46986077 AGGGAGAAACAGTGAGACCCAGG + Intronic
954303214 3:49712262-49712284 AGGGCGCATTACTGTGACCCAGG - Intronic
961482970 3:127195913-127195935 AGGGCACATCAGGTAGCCCCAGG - Intronic
966329016 3:178790277-178790299 ACGGGGCTTCAGTGAGACCCAGG + Intronic
966365682 3:179184877-179184899 AGGGCTAATCAGTGAGATGCAGG + Intronic
966886877 3:184381764-184381786 AGAGCGCAGCAGCGAGACTCGGG - Exonic
976985349 4:91288857-91288879 AGGCCACATCAGTGACAGCCAGG + Intronic
977810121 4:101347693-101347715 AGGGCGCATCACTCAGTGCCAGG + Intronic
982399864 4:154954412-154954434 AGTGTGCATGAGTGAGGCCCAGG - Intergenic
983430909 4:167649851-167649873 CCCGGGCATCAGTGAGACCCTGG - Intergenic
984363035 4:178761837-178761859 AGGCTGCAGCACTGAGACCCTGG + Intergenic
984411388 4:179403061-179403083 AGGGATGATCAGTGAGCCCCGGG + Intergenic
985948874 5:3207685-3207707 AGTGCCCATCAGTGACATCCTGG - Intergenic
986182871 5:5409704-5409726 AGGGCACAGGACTGAGACCCAGG + Intergenic
986530061 5:8726790-8726812 AGTGCGAATCAGGGAGGCCCAGG - Intergenic
994740097 5:103607169-103607191 AGGGCGAATCAGTGAAACTGGGG - Intergenic
998520122 5:142792783-142792805 AGGGCACATCAGGGAAACACAGG - Intronic
1001390911 5:171378658-171378680 AATGCGCATCAGTGAGAGACTGG - Intergenic
1002596866 5:180329311-180329333 AGGGGGCTTCAGGCAGACCCTGG + Intronic
1003443867 6:6167514-6167536 AGCTCGCATCAATGAGACCAGGG - Exonic
1006914262 6:37584602-37584624 AAGACGCAGCAGTGAGCCCCAGG - Intergenic
1015575404 6:134665952-134665974 ACGGAGCATCAGTGTGATCCAGG - Intergenic
1016153972 6:140780783-140780805 AGAGCCCAGCAGTGACACCCAGG + Intergenic
1019548275 7:1589026-1589048 GGGGAGCATCAGTCACACCCTGG + Intergenic
1020136303 7:5590014-5590036 AGGGCGCAGCAGGAAGCCCCAGG + Intergenic
1023550278 7:41362670-41362692 TGGGAGCATCAGTGAAACCTTGG + Intergenic
1027053544 7:75034664-75034686 AGGCAGCATCAGCTAGACCCAGG + Intronic
1033532482 7:142279063-142279085 AGTGCCCATCAGTGACACACTGG + Intergenic
1035626596 8:1075686-1075708 AGGGCCCGTCAGTGAGAGCAAGG + Intergenic
1035724851 8:1817967-1817989 ACGGCGCTCCAGGGAGACCCTGG - Intergenic
1040337363 8:46422880-46422902 AGGGCGAAGCAGCGAGACCGCGG + Intergenic
1048890424 8:138941998-138942020 AGGGCCCATCAGGGAGTCACTGG + Intergenic
1049365031 8:142232967-142232989 AGGGGGCTGCAGTGAGCCCCAGG - Intronic
1053602104 9:39621215-39621237 AGGGGGCTTTAGTGAGCCCCTGG - Intergenic
1053859760 9:42374979-42375001 AGGGGGCTTTAGTGAGCCCCTGG - Intergenic
1054251433 9:62721218-62721240 AGGGGGCTTTAGTGAGCCCCTGG + Intergenic
1054565543 9:66755736-66755758 AGGGGGCTTTAGTGAGCCCCTGG + Intergenic
1060520298 9:124290469-124290491 AGGACGCGTGAGTGAGATCCTGG - Intronic
1061974297 9:134060706-134060728 ATGGGGCATGAGTGGGACCCAGG - Intronic
1190047344 X:47123289-47123311 AGGGGGCATCTGTGAGGCTCAGG + Intergenic
1190603692 X:52118735-52118757 AGGCCACATCCTTGAGACCCAGG + Intergenic
1193643971 X:84044507-84044529 AGGAGGCAGCAGTGAGTCCCTGG - Intergenic
1198859403 X:141053591-141053613 AGGGCACATCACGGAGACCAGGG + Intergenic
1198903292 X:141533800-141533822 AGGGCACATCACGGAGACCAGGG - Intergenic
1199623323 X:149717971-149717993 AGGGCACATGAGGGAGACCAAGG - Intergenic
1200887886 Y:8288530-8288552 AGTGCCCATCAGTGATAGCCTGG - Intergenic