ID: 1083663479

View in Genome Browser
Species Human (GRCh38)
Location 11:64262791-64262813
Sequence CTCACCTTGGGGAAGTCGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083663479_1083663489 6 Left 1083663479 11:64262791-64262813 CCCTTCGACTTCCCCAAGGTGAG 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1083663489 11:64262820-64262842 CCCTGCACCCGCCCAGGCACAGG 0: 1
1: 0
2: 2
3: 48
4: 451
1083663479_1083663486 0 Left 1083663479 11:64262791-64262813 CCCTTCGACTTCCCCAAGGTGAG 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1083663486 11:64262814-64262836 CCTGGCCCCTGCACCCGCCCAGG 0: 1
1: 0
2: 20
3: 94
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083663479 Original CRISPR CTCACCTTGGGGAAGTCGAA GGG (reversed) Exonic
902792605 1:18779113-18779135 CTCACCATGGGGGTGTCCAAGGG + Intergenic
904484805 1:30817672-30817694 CTCAACTGGGGGAAGTGAAAAGG + Intergenic
911565487 1:99458471-99458493 CTCACCTAAGGGAAGTAAAAAGG + Intergenic
916119818 1:161519144-161519166 TTCCCCTTGGGGAAGACGAAGGG + Exonic
916129583 1:161600795-161600817 TTCCCCTTGAGGAAGACGAAGGG + Intronic
918082231 1:181216658-181216680 ATCACCTAGGAGAAGTCAAAAGG - Intergenic
1066306656 10:34150884-34150906 CTCACATTGAGGAAGTAGGAAGG - Intronic
1068852006 10:61753408-61753430 CTCACCCTGAGGAAGTTGCAAGG + Intronic
1070335810 10:75454344-75454366 CTCACTTTGGGGTAGTAAAACGG + Intronic
1072926243 10:99620040-99620062 CTCACCTTGACGCAGTCGATGGG + Exonic
1074533959 10:114315502-114315524 CTCTCCTTGGGGAAGGGGCAGGG - Intronic
1074535358 10:114324994-114325016 CTCACCCTGGGGAAGCTGGAAGG - Intronic
1077652691 11:3987983-3988005 CTCACCTTTGGGCAGTGGTATGG - Intronic
1080679006 11:34456185-34456207 CTCACCTTGGTGAGATCGAATGG - Exonic
1083178433 11:60968242-60968264 CTCACCTAAGGGAATTCTAAAGG - Intergenic
1083663479 11:64262791-64262813 CTCACCTTGGGGAAGTCGAAGGG - Exonic
1084917760 11:72442390-72442412 TTCACATTGGGGAAGTGGAGTGG + Intergenic
1086258217 11:84905843-84905865 CAGACTTTGGGGAAGTCTAAAGG - Intronic
1089254495 11:117187147-117187169 CTCTCCTTAGGGAAGACAAAGGG + Intronic
1090266084 11:125353841-125353863 CTCAGCTTGGGGAAGGCCAATGG - Intronic
1090878292 11:130811122-130811144 CTCACGTGGTGGAAGTTGAACGG + Intergenic
1094408154 12:30140936-30140958 CTTAACTTGGGGAAGCAGAAAGG - Intergenic
1099310991 12:81022632-81022654 CTCACCAAGGGGAAGCCAAACGG - Intronic
1101293342 12:103394755-103394777 CTCTCCTTGGGGAATAAGAATGG - Intronic
1101972091 12:109322041-109322063 CTATCCTTGGGGAAGTGGATGGG + Intergenic
1102149703 12:110680275-110680297 CACACCTTGGGGAACTCCCAGGG - Intronic
1118148052 14:63162097-63162119 CTCACATTGGGGAAGGGGCAAGG - Intergenic
1119956941 14:78808832-78808854 TTCACTTTGGGGAATTCAAATGG + Intronic
1121512200 14:94520822-94520844 CTCTCCTGGGGGAAGTGCAATGG + Intergenic
1122345200 14:101054248-101054270 CTCCCCTTGGAGAAGTGGAAGGG + Intergenic
1126151877 15:45530708-45530730 CATACCTTGGGGCAGTTGAAAGG + Intergenic
1127661905 15:61107437-61107459 CTCACCTTGGGCAAGTTGGTAGG + Intronic
1128021548 15:64395514-64395536 CTCACCTTGGCCAAATCAAAAGG - Exonic
1128205498 15:65848182-65848204 CTCACCTGAGTGAAGTCCAAAGG + Intronic
1128822807 15:70675863-70675885 CTCACCTGGCAGAAGGCGAAAGG - Intronic
1134665875 16:16018176-16018198 CTCACCTTGTGGGTGACGAAAGG + Intronic
1203057938 16_KI270728v1_random:942337-942359 CTGACCTTAGGGAAGTTAAAGGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1148756408 17:49975376-49975398 CTCACCTTGGGGAAGGAGGAGGG + Intergenic
1150240902 17:63631794-63631816 CTTCCCATGGGGAAGTCAAAGGG - Intronic
1156395252 18:36693406-36693428 CTCACCTTGGGGATGGTGAGGGG - Exonic
1162583980 19:11547788-11547810 CCCACCTAGGCGAAGACGAAAGG + Exonic
1163103139 19:15109412-15109434 CTCACCTTGGGGAAGGGGATGGG - Intronic
925043960 2:756796-756818 CTCACAGTGGGGAGGTGGAAGGG - Intergenic
927844473 2:26464323-26464345 CTCTGCTTGGGGAAGTTGACTGG + Intronic
932582267 2:72999726-72999748 CTCACCTTGGGGGAGAGGAGGGG - Intronic
934161098 2:89250434-89250456 CTCACGTTGTGGAGGTGGAAGGG - Intergenic
934206179 2:89931999-89932021 CTCACGTTGTGGAGGTGGAAGGG + Intergenic
938175963 2:129129028-129129050 CTCAACTTGGGAAATTCCAAGGG + Intergenic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
948213810 2:236214357-236214379 CTTACCTTGGGGAAGGCGTCGGG + Exonic
948724400 2:239922862-239922884 CACACCTTTGCGAAGTAGAAAGG + Intronic
1170347061 20:15399123-15399145 GTCTGCTTGGGGAAGTCAAAGGG - Intronic
1174253464 20:49236493-49236515 CTCACCTTGGGGAAGTATCCTGG - Exonic
1177413337 21:20760449-20760471 CTCACATTGGGGATGTGGGAGGG + Intergenic
1179390004 21:40979765-40979787 CTCACCTGGCAGAAGTGGAAGGG - Intergenic
1184608942 22:45590381-45590403 CTCACCTTGGGGGATTGCAAGGG + Intronic
953412378 3:42697675-42697697 CTCACCTGGGGGGATGCGAAGGG + Exonic
953679623 3:45029701-45029723 CTCAGCTTGGGGAAGTGGGTGGG - Intronic
953927734 3:46990887-46990909 GTCATCATGGGGAAGTGGAAGGG + Intronic
958631423 3:96688174-96688196 CTCACATTGGGGAAATAGGAAGG + Intergenic
961511267 3:127405228-127405250 CTCACCTTGGGTGAGTAGGAAGG + Intergenic
964145878 3:153462721-153462743 AACACCTTAAGGAAGTCGAAAGG + Intergenic
969370887 4:6731046-6731068 GTCACCCTGGGGAAGTAGAGCGG + Intergenic
979124613 4:116952655-116952677 CTCACCTTGTGGAAGTGGAGTGG + Intergenic
981977546 4:150748883-150748905 TTCACCTGGTGGAAGCCGAAAGG - Intronic
982116666 4:152104014-152104036 GTGACCTTGGGGAAGGGGAATGG - Intergenic
985666043 5:1181948-1181970 GTCACTTCGGGGAAGTCCAAGGG - Intergenic
988728113 5:33943581-33943603 CTCATCATGGGGCAGTTGAAGGG + Intergenic
990568158 5:57051018-57051040 CTCACCTATGGGCAGTCTAAGGG - Intergenic
991509991 5:67365764-67365786 CTCTCCTGGGGGAAGTGGAGTGG - Intergenic
992711403 5:79460949-79460971 CTAAGATTGGGGAAGTGGAAGGG + Intronic
995280462 5:110330209-110330231 CACACCTTGGTGAAGCCAAATGG + Intronic
995561847 5:113390642-113390664 CTAACCTTGGGGATGTATAATGG + Intronic
998330764 5:141324747-141324769 CTCTCCTTGTGGAATTCTAAAGG + Intergenic
1003029697 6:2591344-2591366 CTCACCTTGGCAGAGTCAAAAGG - Intergenic
1005143275 6:22658599-22658621 CTTACCTTGGGGCAGGCAAAGGG + Intergenic
1005169711 6:22968874-22968896 CTCACCTGGTGGAAGGTGAAGGG + Intergenic
1005596946 6:27388950-27388972 CTGGGCTTGGGGAAGTCGGAAGG - Exonic
1005991836 6:30908061-30908083 GGCACCGTGGGGAAGCCGAAAGG - Intergenic
1006402067 6:33823621-33823643 CTCACGCTGGGGAATTCGACTGG - Intergenic
1009309781 6:62135308-62135330 CTCACATTGCGGAAGGCAAAAGG - Intronic
1009844077 6:69114164-69114186 CTTACCTAAGGGAAGTTGAAAGG - Intronic
1011192845 6:84750984-84751006 CTTACCTTGGAGAAGAGGAAGGG - Intronic
1013064459 6:106670255-106670277 CACTCCTTGGGGTAGTCGGAGGG + Intergenic
1016914916 6:149235861-149235883 CTCCCCCTGTGGAAGTCAAAGGG - Intronic
1022318608 7:29266939-29266961 CTCACCTTGAGGAGGGAGAAGGG - Intronic
1025858906 7:65308185-65308207 CTCACCTTGGGACAGTTGCAAGG - Intergenic
1026146643 7:67752256-67752278 CTCACCTGGAGGAAGCAGAAAGG - Intergenic
1027593100 7:80138968-80138990 CTCAACTAGGGGAAGTCACAGGG - Intronic
1029147688 7:98458481-98458503 GTCAGCCTGGGGATGTCGAAGGG + Intergenic
1030648745 7:112093997-112094019 CTTACCCTGGGTAAGTCAAATGG - Intronic
1038081924 8:24147623-24147645 TTCACCTTGAGGAACTAGAAAGG - Intergenic
1041630710 8:60083579-60083601 CTCCGCTTGTGGAAGTTGAATGG - Intergenic
1043098409 8:76006177-76006199 CTCACATGGGGGAAGGTGAAAGG - Intergenic
1044184893 8:89239707-89239729 CTCCCCTAGGGGAAGGGGAAGGG - Intergenic
1044216587 8:89619099-89619121 CTAACCATGGGGAAGTCTAGAGG - Intergenic
1044325989 8:90858996-90859018 CTCAATTTGGGGAATTCCAAAGG - Intronic
1049436551 8:142588757-142588779 CTAACCATGGGGACGGCGAAAGG - Intergenic
1056796685 9:89663424-89663446 GGCACCTTGGGGAAGTCCCAGGG + Intergenic
1057842413 9:98496580-98496602 GTCACCCTGGGGAAGTCAATTGG + Intronic
1059858284 9:118426734-118426756 CTCACCTATGAGAAGTCCAAGGG - Intergenic
1061548162 9:131316665-131316687 CTCACCTGGGGGAAGGGGAAGGG - Intergenic
1189718997 X:43895708-43895730 CTCACTTTGTGGAAGGCGGAAGG - Intergenic
1189752791 X:44239593-44239615 GTCACCTTGAGGAAGTTGTATGG + Intronic
1192809866 X:74538042-74538064 CCCTCCTTGGGGAAGTCCAGGGG - Intergenic
1198120746 X:133590133-133590155 CTCACCTGGGGGAAGGCAAAAGG - Intronic
1198438778 X:136641524-136641546 CTCACCTTGGGGACCTGGGATGG + Intergenic