ID: 1083663739

View in Genome Browser
Species Human (GRCh38)
Location 11:64263877-64263899
Sequence CTGGATGGCCCCGACTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083663734_1083663739 -1 Left 1083663734 11:64263855-64263877 CCAGGGCCTGGGAGTGGCCGAGC 0: 1
1: 1
2: 2
3: 45
4: 389
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1083663723_1083663739 28 Left 1083663723 11:64263826-64263848 CCAGGGAGTGTGAGGGACAAGGG 0: 1
1: 0
2: 2
3: 39
4: 351
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1083663732_1083663739 1 Left 1083663732 11:64263853-64263875 CCCCAGGGCCTGGGAGTGGCCGA 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1083663736_1083663739 -7 Left 1083663736 11:64263861-64263883 CCTGGGAGTGGCCGAGCTGGATG 0: 1
1: 0
2: 6
3: 24
4: 202
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1083663731_1083663739 2 Left 1083663731 11:64263852-64263874 CCCCCAGGGCCTGGGAGTGGCCG 0: 1
1: 0
2: 2
3: 44
4: 480
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1083663733_1083663739 0 Left 1083663733 11:64263854-64263876 CCCAGGGCCTGGGAGTGGCCGAG 0: 1
1: 0
2: 3
3: 37
4: 347
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1083663729_1083663739 5 Left 1083663729 11:64263849-64263871 CCACCCCCAGGGCCTGGGAGTGG 0: 1
1: 0
2: 3
3: 61
4: 677
Right 1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083663739 Original CRISPR CTGGATGGCCCCGACTGAGT AGG Intronic
900476701 1:2879513-2879535 CTGACTGGCCCCCACTGGGTTGG + Intergenic
902664243 1:17926413-17926435 CTGAAAGCCCCAGACTGAGTGGG - Intergenic
907917782 1:58886631-58886653 GTGTATGACCCTGACTGAGTCGG - Intergenic
912356852 1:109061383-109061405 CTGTGTTGCCCAGACTGAGTGGG - Intergenic
912586559 1:110772090-110772112 CTGACTGGCCCTCACTGAGTTGG + Intergenic
1064145971 10:12826712-12826734 CTGGATGGTCCCAAATGAGATGG - Intronic
1070501115 10:77073335-77073357 CTGGATGGCCCTGAGTGGTTGGG - Intronic
1071509497 10:86252296-86252318 CTGGATGGATGTGACTGAGTTGG - Intronic
1078067837 11:8089744-8089766 CTGGATGATCCCGTCTGATTGGG + Intronic
1079533596 11:21484983-21485005 CTGGTTGGCCAGGACTGACTAGG + Intronic
1083571651 11:63764654-63764676 CAGGATGGACCCCTCTGAGTGGG - Intronic
1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG + Intronic
1083885316 11:65570620-65570642 CTGGGAGCCCCCGACTGAGGCGG + Exonic
1086723617 11:90152456-90152478 CTGGATAGCCTGGAGTGAGTGGG - Exonic
1096215783 12:49796794-49796816 CTGGGTGGTCCCCATTGAGTGGG + Exonic
1102912503 12:116728345-116728367 CTGGATGGCAGAGACAGAGTGGG - Intronic
1104076026 12:125390828-125390850 CTGGATGGCTCTGACTCAGGTGG - Intronic
1105922848 13:24981954-24981976 CTGGATGCCCCCGAGTGTTTCGG + Intergenic
1107856315 13:44618651-44618673 CTGGATTGCCCAGCCTGTGTGGG + Intergenic
1115739461 14:36372772-36372794 CTGGATGCTACAGACTGAGTGGG - Intergenic
1119788082 14:77327425-77327447 CTGGGTGGCCTGGCCTGAGTTGG - Intronic
1122300737 14:100729574-100729596 CTGGGGGGCCTGGACTGAGTGGG + Intronic
1131979574 15:97981659-97981681 CTGAGTGGCCCCTGCTGAGTGGG + Intergenic
1132554886 16:568057-568079 CTGGAGGGCCCCTGCTGGGTGGG + Exonic
1133009458 16:2902580-2902602 CAGGCTGGCCCCCACTGGGTTGG - Intergenic
1138778911 16:59758787-59758809 CTGCATGGCCCAGAATGTGTGGG + Intergenic
1140658420 16:77164100-77164122 CTTGATGGCTCTGACTTAGTGGG + Intergenic
1148911434 17:50945009-50945031 CTGGCTGGCCCCCACTGGCTTGG - Intergenic
1151304824 17:73256494-73256516 CTGGATGCCCCTGACTCAGGAGG - Intronic
1151475382 17:74342040-74342062 CTGGAGGGCCCCTCCTGAGTGGG - Intronic
1156465954 18:37347946-37347968 CTGGTTGGCCCCTTCTGAGCTGG - Intronic
1158931539 18:62328537-62328559 TTGGATGGCCCTTACTGAGGTGG + Intronic
1166558243 19:43715901-43715923 CTGGAGGGCCCAGTGTGAGTGGG + Intergenic
925712670 2:6757304-6757326 CTGGGTGGCCAGGGCTGAGTGGG - Intergenic
926141605 2:10371453-10371475 CTGGATAGCCCCACCTGGGTAGG + Intronic
937123137 2:119454485-119454507 GTGGCTGGTCCCTACTGAGTTGG + Intronic
937443480 2:121936679-121936701 CTGGATGGGCCTCACTGAGAAGG + Intergenic
941573083 2:167195902-167195924 CTGCAGGGCCCAGGCTGAGTGGG - Intronic
946130646 2:217604165-217604187 CAGGGTGGCCCAGACTGAATGGG - Intronic
948377517 2:237531253-237531275 CTGGATGGACTTGGCTGAGTTGG - Intronic
948726946 2:239939914-239939936 CTGGTCAGCCCTGACTGAGTAGG - Intronic
1175828407 20:61949545-61949567 CTGGATGGCACCATCTGTGTGGG - Intergenic
1179999960 21:44991113-44991135 CTGGATGGCCGTGGCTGAGCTGG + Intergenic
1184409441 22:44318074-44318096 CTGGATGGGCTGGACTGGGTCGG - Intergenic
1184429997 22:44437129-44437151 CTGGAGGGCTCTGACTGAGCAGG + Intergenic
1184681337 22:46073803-46073825 CTGGCTGGACCCGACTGAAATGG - Intronic
950696013 3:14701764-14701786 CTGGACGGCCCTCACTGAATTGG - Intronic
952966950 3:38627119-38627141 CTGGATTGTCACGACTGAGCAGG + Intronic
953902318 3:46850246-46850268 CTGTATGGCCCAGGCTCAGTGGG - Intergenic
960582451 3:119292719-119292741 GTGGATGGTCCTCACTGAGTGGG + Intergenic
969414488 4:7049797-7049819 CCGCATGGCCGTGACTGAGTTGG + Intronic
970829671 4:20322079-20322101 CTGGCTGGCCTGTACTGAGTAGG - Intronic
986340660 5:6786481-6786503 CAGGAGGGCCGCTACTGAGTGGG + Intergenic
991400196 5:66244031-66244053 CTGGATGGCCCTTCCTGAGTGGG + Intergenic
996697700 5:126417132-126417154 CTAGATGGCCCCTAGTGAGTTGG + Intronic
1002531800 5:179851305-179851327 CTGGTTGGCCCAGGCTGACTCGG - Intronic
1024005237 7:45220288-45220310 CTGGGTGACCCCCACTCAGTTGG - Intergenic
1024178218 7:46862193-46862215 CTGCATGGGGCCGTCTGAGTCGG - Intergenic
1038517396 8:28199149-28199171 CTGGATTCTCCTGACTGAGTGGG - Intergenic
1056911935 9:90708933-90708955 CAGGATAGCCTCGACTGATTAGG - Intergenic
1060301137 9:122375227-122375249 CTGGATGGGCCGGACTGGGAGGG + Intronic
1060432734 9:123564417-123564439 CTGGAAGGCCCCGTTTGATTTGG + Intronic
1061055012 9:128217917-128217939 CTGAATGGCCGTGGCTGAGTTGG + Intronic
1061250815 9:129425344-129425366 CTGGATGGAGCCTGCTGAGTGGG - Intergenic
1187318592 X:18220645-18220667 CTGGATGGCACCCACTTAGGTGG - Intronic
1191254072 X:58272320-58272342 CTCCATGACCCCGACGGAGTGGG + Intergenic
1191715258 X:64189970-64189992 CTGGAAGGCCCATAGTGAGTGGG + Exonic
1192186751 X:68952256-68952278 CTGGATGGCCCCGCCGGCCTGGG + Intergenic
1192340160 X:70257741-70257763 GTGGATGGCTCAGACTGAGGGGG - Intergenic
1195342414 X:103918655-103918677 CTGGATGCTGCCGACTGGGTAGG - Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic