ID: 1083664609

View in Genome Browser
Species Human (GRCh38)
Location 11:64267711-64267733
Sequence CAGGAAGGAGGGGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 9, 3: 100, 4: 638}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083664609_1083664618 -3 Left 1083664609 11:64267711-64267733 CCTCCTGGGGCCCCTCCTTCCTG 0: 1
1: 0
2: 9
3: 100
4: 638
Right 1083664618 11:64267731-64267753 CTGCCCTCAGTCTTAGGTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1083664609_1083664622 8 Left 1083664609 11:64267711-64267733 CCTCCTGGGGCCCCTCCTTCCTG 0: 1
1: 0
2: 9
3: 100
4: 638
Right 1083664622 11:64267742-64267764 CTTAGGTTAGGGCCTTGGTCAGG 0: 1
1: 0
2: 2
3: 19
4: 122
1083664609_1083664614 -9 Left 1083664609 11:64267711-64267733 CCTCCTGGGGCCCCTCCTTCCTG 0: 1
1: 0
2: 9
3: 100
4: 638
Right 1083664614 11:64267725-64267747 TCCTTCCTGCCCTCAGTCTTAGG 0: 1
1: 0
2: 9
3: 57
4: 777
1083664609_1083664621 3 Left 1083664609 11:64267711-64267733 CCTCCTGGGGCCCCTCCTTCCTG 0: 1
1: 0
2: 9
3: 100
4: 638
Right 1083664621 11:64267737-64267759 TCAGTCTTAGGTTAGGGCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 81
1083664609_1083664623 9 Left 1083664609 11:64267711-64267733 CCTCCTGGGGCCCCTCCTTCCTG 0: 1
1: 0
2: 9
3: 100
4: 638
Right 1083664623 11:64267743-64267765 TTAGGTTAGGGCCTTGGTCAGGG 0: 1
1: 0
2: 2
3: 17
4: 189
1083664609_1083664617 -4 Left 1083664609 11:64267711-64267733 CCTCCTGGGGCCCCTCCTTCCTG 0: 1
1: 0
2: 9
3: 100
4: 638
Right 1083664617 11:64267730-64267752 CCTGCCCTCAGTCTTAGGTTAGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083664609 Original CRISPR CAGGAAGGAGGGGCCCCAGG AGG (reversed) Intronic
900089175 1:912124-912146 AAGAAAGGAGGGGACCCAGGAGG - Intergenic
900121049 1:1048888-1048910 CAGGAAGGAGCGGCCCTCGAAGG - Exonic
900164969 1:1240898-1240920 CCGGATGGTGAGGCCCCAGGCGG + Intergenic
900372128 1:2336755-2336777 CAGGCGGGGGCGGCCCCAGGAGG + Exonic
900425358 1:2575909-2575931 AGGGAAGGAGCGGCCCAAGGAGG - Intergenic
900514822 1:3076635-3076657 CAGGAAGGAAAGGGCTCAGGAGG + Intronic
900611511 1:3546505-3546527 CAGGAAGGAGGGTGCCAGGGAGG + Intronic
900706951 1:4086912-4086934 CAGGAGGGAGGGGCCCTTGTGGG - Intergenic
900808113 1:4781205-4781227 TGGGGAGGAGGGGCCCCAGGTGG - Intronic
901059505 1:6465598-6465620 CAGCAGGGAGAGGCCCCACGTGG - Intronic
901215058 1:7550544-7550566 CAGGTAGGAGGGGCCCAGGTGGG - Intronic
901492127 1:9602005-9602027 AAGGAAGGCGTGGACCCAGGAGG + Intronic
902241201 1:15090539-15090561 CAGGAAGGTGGGGCCCTGGCGGG + Intronic
902613198 1:17609122-17609144 CATGCAGGAATGGCCCCAGGTGG - Intronic
903736432 1:25532628-25532650 CAGGAAGGAGGGAAGCCCGGAGG + Intergenic
903777214 1:25800548-25800570 CGGGAAGGAGGGGACACGGGAGG + Intronic
904003129 1:27349772-27349794 CGGGAGGGAGGGGACCCGGGCGG + Intronic
904285815 1:29452711-29452733 CATGAAGAAGAGGCCCCGGGAGG - Intergenic
904312097 1:29635543-29635565 CAGCAAGGAGGGGTCCCAGAAGG + Intergenic
904329598 1:29749567-29749589 CAGGAAGGAGGGGAGAGAGGGGG + Intergenic
904466014 1:30707941-30707963 CAGGAAGGAGCACCCCAAGGAGG - Intergenic
904598487 1:31661281-31661303 CAGGCACCAGTGGCCCCAGGAGG + Intronic
905433879 1:37943783-37943805 CTGGAAGAAGGTGCCACAGGGGG - Exonic
905457797 1:38100502-38100524 AAGGAAGGGGTGGACCCAGGAGG - Intergenic
905474853 1:38218874-38218896 CAGGAGGCTGAGGCCCCAGGTGG + Intergenic
905911580 1:41658629-41658651 GAGGAAGCAGGGGCTCAAGGGGG + Intronic
907260767 1:53216911-53216933 CAGGAAGGAGAGGGGCCATGGGG - Intronic
907313326 1:53552270-53552292 CCGGTAGGAGGGGGACCAGGCGG + Intronic
907545684 1:55258137-55258159 CAGGGAGGGGGAGCCCCAGCTGG - Intergenic
907872357 1:58454651-58454673 GAGGAGGGAGGGTCCCCAGGTGG - Intronic
909712998 1:78673521-78673543 CAGCAAGCAGTGGCCCCAGTAGG + Intergenic
911612347 1:99970501-99970523 AAGGAATGACGGGCCCCAGCCGG - Exonic
912452255 1:109774292-109774314 CAGGAGGGTGGGGCGTCAGGAGG + Intronic
913500727 1:119470427-119470449 GAGGATGGATGGGTCCCAGGAGG - Intergenic
913680953 1:121186642-121186664 CAGGAACGCGGGGCACCGGGCGG - Intronic
914032784 1:143974281-143974303 CAGGAACGCGGGGCACCGGGCGG - Intergenic
914156662 1:145093684-145093706 CAGGAACGCGGGGCACCGGGCGG + Intronic
914313767 1:146489456-146489478 AATGAAGGATGGGCCCCAAGTGG + Intergenic
914500582 1:148243925-148243947 AATGAAGGATGGGCCCCAAGTGG - Intergenic
914504200 1:148274723-148274745 AATGAAGGATGGGCCCCAAGTGG - Intergenic
914829226 1:151158535-151158557 GAGGACTGAGGGGCCCCAGGGGG + Intronic
915018786 1:152760670-152760692 AGGGCAGGAGGCGCCCCAGGAGG - Exonic
915459299 1:156060312-156060334 AAGGAATGAGGAGCCCCAGGAGG - Intergenic
915459540 1:156061546-156061568 AAGGAATGAGGAGCCCCAGGAGG - Intronic
915526479 1:156479416-156479438 CATGAAGAGGGGACCCCAGGAGG + Intronic
915580617 1:156810854-156810876 CAGGAGAGAGGAGCCCCATGTGG + Intronic
915631748 1:157158003-157158025 CTGGAAGGAGCAGCTCCAGGAGG - Intergenic
915838000 1:159193374-159193396 TAGGAAGGAGAGGCCCCATGGGG - Intronic
915913778 1:159929569-159929591 CAGGTAGGAGGGGCTTAAGGAGG + Intronic
915915253 1:159936921-159936943 CAGGCATCAGGGGCCCCAGTGGG + Intronic
917041075 1:170807116-170807138 CAGGAAGAAGGGGCCCAGGTTGG + Intergenic
917141777 1:171842028-171842050 CAGGCAGGAGGGCCACCAGGCGG - Intronic
917211151 1:172633172-172633194 AAGGAAGAAGGGGCCCCAGGTGG - Intergenic
917291523 1:173476933-173476955 CAGGAAGGCGAGCCCCAAGGTGG - Intergenic
918145128 1:181749362-181749384 CAGGAAACTGAGGCCCCAGGAGG - Intronic
918187731 1:182142833-182142855 CGGGAGGCAGGGGTCCCAGGCGG + Intergenic
918719858 1:187839163-187839185 AAGGGGGAAGGGGCCCCAGGAGG - Intergenic
918730868 1:187994494-187994516 CAGAAAGCAGGGGCCTCAGAAGG + Intergenic
919765917 1:201127283-201127305 GAGGGAGGAGGGGCGGCAGGGGG + Intergenic
919813189 1:201421811-201421833 GAGGGAGGAGGGGCAGCAGGAGG - Intronic
919887363 1:201944662-201944684 GAGGAAGGAGGGAAGCCAGGAGG - Intronic
920013966 1:202890688-202890710 AAGGAAGGAGGAGCCACATGAGG - Intergenic
920092368 1:203463793-203463815 CAGGACTGAAGGGCTCCAGGAGG + Intergenic
920110400 1:203583306-203583328 CAGGAAGTAGGGGGCCTGGGGGG - Intergenic
920468266 1:206205166-206205188 CAGGAACGCGGGGCACCAGGCGG - Intronic
921006045 1:211094572-211094594 CAGGAAGTAGGGGTGCCCGGTGG - Intronic
921039555 1:211416732-211416754 CAGGAAGGAGAGGGCCACGGTGG - Intergenic
921432838 1:215083150-215083172 CGGGAAGGAGGGGACACCGGCGG - Intronic
922041639 1:221903599-221903621 CAGAAAGGAGCTGCCCCATGTGG - Intergenic
922244009 1:223777221-223777243 GAGGAAGGAGAGGCCGCAGCAGG - Intergenic
922504568 1:226119062-226119084 CAACAGGGAGGAGCCCCAGGTGG + Intergenic
922574065 1:226650818-226650840 CAGGAAACTGAGGCCCCAGGAGG - Intronic
922597508 1:226825259-226825281 CAAGAGGAAGGGGCCCCAGGTGG - Intergenic
922738842 1:228004690-228004712 AGGGAAGGAGGAGCCCCACGTGG + Intergenic
922767650 1:228164251-228164273 CAGGGTGCATGGGCCCCAGGAGG + Intergenic
922800608 1:228363072-228363094 CAGGGAGGAGGGGGAGCAGGGGG + Intronic
923018880 1:230147718-230147740 CAGGAAGGAGGGACTCTTGGAGG - Intronic
923043536 1:230337251-230337273 AAGGAAGGTGGGGGCCCAGATGG - Exonic
923046945 1:230362482-230362504 CATGAAGCTGGAGCCCCAGGAGG - Intronic
923893614 1:238243132-238243154 CAGGAAGAAGCAGCCACAGGAGG - Intergenic
923957471 1:239039330-239039352 GAGGAAGGAGGAGCCCAAAGTGG - Intergenic
924039046 1:239965379-239965401 CAGGAAGCAAAGGCCCAAGGAGG + Intergenic
924742853 1:246806941-246806963 CAGGAAGGAGGGAGCTGAGGGGG + Intergenic
1062818668 10:518239-518261 CAGGCAGCAGGGGCAGCAGGTGG - Intronic
1064323378 10:14327074-14327096 CAGCTGGGAGGGGTCCCAGGTGG - Intronic
1065773821 10:29101357-29101379 CAGGATGGAGCAGCCACAGGAGG + Intergenic
1065968476 10:30787206-30787228 CAGGATGGAGGGGACCCAGCAGG - Intergenic
1066703689 10:38156493-38156515 CCGGAGGGTGGGACCCCAGGGGG + Intergenic
1067030258 10:42875065-42875087 CAGGCTGGAGGGGCCACAGTAGG + Intergenic
1067346977 10:45444037-45444059 CGGGGAGGACGGGGCCCAGGGGG + Intronic
1069622771 10:69847994-69848016 GAGGAAGGAGGTGGGCCAGGGGG - Intronic
1069687000 10:70324758-70324780 CAGGAAGCAAGGGCAGCAGGTGG + Intronic
1069749541 10:70736485-70736507 GAGAAAGGAGGGGTCCCTGGAGG + Intronic
1069783415 10:70971140-70971162 CAGAATGGAGAGTCCCCAGGAGG + Intergenic
1069795923 10:71051668-71051690 GAGGAAGGAGAGTCCCCAGCAGG + Intergenic
1069854469 10:71432110-71432132 CAGGAAGGAGGGGCCCTCCAGGG + Intronic
1070858586 10:79629719-79629741 AAAGAAAGAGAGGCCCCAGGTGG - Intergenic
1071941414 10:90595513-90595535 GAGATAGGAGAGGCCCCAGGAGG - Intergenic
1072221544 10:93331543-93331565 CAGGAAGGAGGGCTCCCGTGAGG - Intronic
1073121028 10:101122746-101122768 CAGGAAGGTGGAGCCCATGGCGG + Intronic
1074160028 10:110829539-110829561 AGGGAAGGAGGGAGCCCAGGAGG - Intronic
1074545966 10:114402964-114402986 AAGGGCGGAGGGGCCCCAGTAGG + Intronic
1075005524 10:118827322-118827344 AGGGAGGGTGGGGCCCCAGGAGG - Intergenic
1075115865 10:119626794-119626816 CTGGATGGAGGGGCCACAGATGG + Intergenic
1075172499 10:120128389-120128411 CAGGAAGGGCGGGGCCAAGGTGG - Intergenic
1075671787 10:124268039-124268061 CAGGAGGCAGGGGCACCAGGAGG + Intergenic
1075839989 10:125493586-125493608 CACCAAGGATGTGCCCCAGGAGG + Intergenic
1076124156 10:127961491-127961513 AGGGAAGGAGGGCCCCCAGGAGG + Intronic
1076148430 10:128143686-128143708 CAGGAAGGAAGAAGCCCAGGGGG - Intergenic
1076294993 10:129377110-129377132 CTGGAATGAGGGCCCACAGGAGG - Intergenic
1076365326 10:129918076-129918098 CAGTTAGGAAGGGGCCCAGGTGG + Intronic
1076736737 10:132462390-132462412 CAGGAAGGCTGGGCTCCAGGAGG + Intergenic
1076747332 10:132521077-132521099 CAGTGAGGACGGGGCCCAGGAGG - Intergenic
1076762705 10:132613277-132613299 CGGGAAGGAGGGGGCCCTGCGGG - Intronic
1076762719 10:132613306-132613328 CGGGAAGGAGGGGGCCCTGCGGG - Intronic
1076803873 10:132845513-132845535 AAGGAGGGAGGGGCCCCATTAGG + Intronic
1076839416 10:133038724-133038746 CAGGAGAGAGGTGACCCAGGAGG - Intergenic
1077162845 11:1121492-1121514 AAAGAGGGCGGGGCCCCAGGAGG + Intergenic
1077166307 11:1141006-1141028 CTGGAATGAGGCGCCCCAGGTGG + Intergenic
1077186635 11:1238408-1238430 CTGGAGGGAAGGCCCCCAGGTGG + Intronic
1077194221 11:1271190-1271212 CAGGCAGGAGGGGCTGCAGTGGG - Intergenic
1077324136 11:1956430-1956452 CAGCAGGGACGCGCCCCAGGTGG + Exonic
1077324164 11:1956523-1956545 CAGCAGGGACGCGCCCCAGGTGG + Exonic
1077392106 11:2304909-2304931 CAGGGAGGAGCTGCCCCAGCTGG - Intronic
1077424336 11:2467293-2467315 CAGGGAGGCAGGGGCCCAGGAGG + Intronic
1077444586 11:2585059-2585081 CAGGCAGGCTGGGCCCGAGGTGG + Intronic
1077477778 11:2798428-2798450 CAGTAAGGAGGCCCCCCAGACGG - Intronic
1077536981 11:3129178-3129200 AAGGAAGGAGGGGCAGCAGGAGG + Intronic
1077868367 11:6241143-6241165 CAGAGAGGAGGGGCCCTTGGTGG + Intronic
1077882012 11:6358304-6358326 CAGGAAGGAGAGGCCAGTGGTGG - Intergenic
1080061620 11:27962378-27962400 CAGGAAGGAGGGGAGCCAGGTGG - Intergenic
1081858905 11:46320820-46320842 CAGGAGGCAGGGGCACGAGGCGG - Exonic
1081869815 11:46378241-46378263 CAGAAAGGAGGGGCCCCAGAGGG - Intronic
1083412536 11:62504348-62504370 CAGGAGGGAGGAGCCCCAGGTGG - Intronic
1083572492 11:63768198-63768220 CAGGCCCGAGGGGCCCCACGGGG - Intronic
1083650758 11:64203245-64203267 GAGGCAGGGGGGGCCCCTGGAGG - Intronic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1083920636 11:65780136-65780158 CCGGCAGGAGGCGCCCGAGGTGG + Exonic
1083936860 11:65873742-65873764 AAGGAAGGGCGGGCCCCAGGCGG - Intergenic
1084151243 11:67289003-67289025 GAGGAAGGCGGGGCCGGAGGGGG - Intronic
1084345111 11:68541821-68541843 CAGGAAGGAGGGGGGACAGTGGG + Intronic
1084420613 11:69058726-69058748 CAGGAAGGAGGTGGCCACGGAGG - Intronic
1084478021 11:69399995-69400017 CAGGAAGCTGGAGGCCCAGGAGG + Intergenic
1084562162 11:69911206-69911228 AGGGAAGGAGTGGCCCCTGGTGG - Intergenic
1085052310 11:73386223-73386245 TGGGGAGGAGGGGCCCCAGGGGG - Intronic
1088082794 11:105939863-105939885 CAGGAAGAAGGCACCCTAGGTGG + Intronic
1088895617 11:114076132-114076154 CAGAAAAGAGGGGCCGCTGGGGG + Intronic
1089356223 11:117855674-117855696 CAGGAAGGAGGAGTCACTGGGGG + Intronic
1090636180 11:128691960-128691982 CAGGAAGGGGGGCCTCCTGGTGG + Intronic
1091284134 11:134398728-134398750 TAGGCAGGAGGGGGCCCGGGAGG - Intronic
1202807122 11_KI270721v1_random:11625-11647 CAGCAGGGACGCGCCCCAGGTGG + Intergenic
1202807150 11_KI270721v1_random:11718-11740 CAGCAGGGACGCGCCCCAGGTGG + Intergenic
1091655720 12:2345360-2345382 CTGGAAGGAGGGCCACAAGGTGG + Intronic
1091750089 12:3016943-3016965 GAGGCAGGAGGGGCCACAGGAGG + Intronic
1091879540 12:3965761-3965783 CAGGAAGGATGGGACCTTGGAGG + Intergenic
1092053890 12:5493108-5493130 CTGGAAGGAGATGCTCCAGGTGG - Intronic
1093990082 12:25580231-25580253 ATGGAAGGAGGGGCCAGAGGGGG - Intronic
1095989932 12:48027609-48027631 CAGTTAAGAGGGGCCGCAGGAGG + Intergenic
1096481382 12:51943562-51943584 CTGGAAGGAGGGTGACCAGGAGG + Intergenic
1096521482 12:52187073-52187095 AAGGGAGGAGAGGCCCCAAGGGG - Intronic
1096653918 12:53076608-53076630 CAGCAAGGAGGGGATCCAGCTGG - Intronic
1096715216 12:53487114-53487136 CAGGATGCAGGGGGCCCAGGGGG - Exonic
1096738853 12:53677159-53677181 CGGGAAGGACGGGGCCAAGGAGG - Intronic
1096790895 12:54044219-54044241 AGGAAAGGAGGGGCCTCAGGTGG - Intronic
1096975707 12:55698335-55698357 AGGGAGGGAGGGGCCACAGGAGG - Intronic
1097681805 12:62656270-62656292 AAGGAAAGAGGGGCTCCAAGAGG - Intronic
1098251343 12:68572825-68572847 CAGGAAGGAGAAACCCCAGAAGG - Intergenic
1101951385 12:109178876-109178898 GAGGAGAAAGGGGCCCCAGGTGG - Intronic
1102248505 12:111369892-111369914 CAGGAAGGAAGGGTTCAAGGAGG - Intergenic
1102496205 12:113320998-113321020 ATGGGAGGAGGGGTCCCAGGAGG - Intronic
1102534381 12:113569862-113569884 TGGGAAGGAGTGGCCCCCGGCGG + Intergenic
1102554632 12:113718975-113718997 CAGGGAGGAGCAGCCCCAGGAGG - Intergenic
1102576481 12:113859168-113859190 CAGGGAAGTGGGGCCCCATGGGG - Intronic
1102974593 12:117197432-117197454 CAGGGAGGAGGGATCCCAGAGGG - Intergenic
1103260601 12:119585171-119585193 CAGAAAGGAGGGGGCCAAGGAGG + Intergenic
1103565800 12:121814662-121814684 CAGGGAGAAGGGGCCCCGGTAGG - Exonic
1103746372 12:123127276-123127298 CAGGTCGCAGGGGACCCAGGAGG + Intronic
1104781319 12:131422263-131422285 CAGGGAGGGGAGACCCCAGGAGG - Intergenic
1104947596 12:132423552-132423574 CAGGGAGCAGCGGCCCCGGGAGG + Intergenic
1105843507 13:24275292-24275314 CAGGAATCAGGGGCCCCCAGAGG + Intronic
1106160075 13:27193543-27193565 AAGGCAGGAGGGAACCCAGGAGG + Intergenic
1106164166 13:27227483-27227505 CAGGAAGGAAGAGCACCCGGAGG + Intergenic
1106589857 13:31089866-31089888 CTGGATGGAGGGTCCCCGGGTGG + Intergenic
1107307472 13:39038068-39038090 CAGGAAAGAGGGGCCCAAGCTGG - Exonic
1107815019 13:44236943-44236965 CAAGATGGAGTGGCCCAAGGAGG + Intergenic
1107958979 13:45542592-45542614 CAGGAAGGAGGTGCCCAGCGAGG - Intronic
1108555219 13:51584741-51584763 GCGGATGGAGGGGTCCCAGGAGG + Exonic
1108602257 13:52005022-52005044 CAGGAAGCAGAGGCTCGAGGTGG + Intronic
1108876181 13:55053884-55053906 TAGGAAGGAGGGGACCCAAAGGG - Intergenic
1110707171 13:78609012-78609034 CGGGAAGGAGGGGCGGCTGGCGG - Intergenic
1111241683 13:85482635-85482657 CAGGGAGCAGTGTCCCCAGGTGG + Intergenic
1112002350 13:95222504-95222526 CAGAAGGGAAGGGCCCCAGAAGG + Intronic
1112097601 13:96151850-96151872 CAGGAAAGAGGGGTGCCATGTGG - Intronic
1112362347 13:98729658-98729680 CTGCAAGGAAGGGCCCCAGAGGG - Intronic
1112580870 13:100675129-100675151 CGGGAAGGGGCGGCCCCAGCTGG + Intergenic
1113611340 13:111646726-111646748 AGGGAAGGAGAGGCACCAGGAGG - Intronic
1113843109 13:113371470-113371492 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843209 13:113371709-113371731 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843232 13:113371768-113371790 GAGGAGGGAGGGGTCTCAGGAGG - Intergenic
1113843240 13:113371787-113371809 GAGGATGGAGGGGCCTCAGGAGG - Intergenic
1113843247 13:113371806-113371828 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843279 13:113371886-113371908 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113983486 13:114295574-114295596 CAGGAAGAGGAGGGCCCAGGAGG - Intronic
1114850948 14:26381960-26381982 AAGGAAAGCGAGGCCCCAGGAGG - Intergenic
1116541931 14:46110168-46110190 CTGGAAGTGGGGACCCCAGGAGG - Intergenic
1116863829 14:50015578-50015600 CTGGAAGGAGGGACCTGAGGTGG - Intergenic
1117791052 14:59342771-59342793 CATGTAGGAGGGGCACCAGCAGG + Intronic
1118315335 14:64722587-64722609 GAGCAAGGAGGGTCCCCATGGGG - Intronic
1118603297 14:67485592-67485614 CAGGAAGGAAGCTCCCCAGAAGG - Intronic
1119319515 14:73721398-73721420 CAGGAAGGAGGGGGAGGAGGAGG - Exonic
1120874496 14:89363154-89363176 CAGGGATGTGAGGCCCCAGGAGG - Intronic
1120889779 14:89481508-89481530 CAGGGAAGTGGGGCCCCATGAGG + Intronic
1121024282 14:90603087-90603109 CAGGAGGGATGGGCTCCAGGTGG + Intronic
1121253698 14:92516752-92516774 CAGGATAGAGGGGCACCAAGGGG - Intronic
1121355158 14:93207612-93207634 CAGGCTGAAGGGGGCCCAGGAGG - Intronic
1121433018 14:93900579-93900601 CAGGCAGGAGGGGAGGCAGGTGG + Intergenic
1121538282 14:94706272-94706294 CAGGAAGCAGTGGCCACGGGAGG - Intergenic
1121775018 14:96584684-96584706 CAGGAAGGAGGGGCGCAGGGAGG + Intergenic
1121944445 14:98105390-98105412 GAGGTAGGAGAGGCCCCTGGAGG + Intergenic
1122350006 14:101083715-101083737 CAGGAAGGGGGTGCCCCGAGTGG - Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122805572 14:104254835-104254857 GAGAACTGAGGGGCCCCAGGGGG + Intergenic
1122929592 14:104927232-104927254 TAGGACTGGGGGGCCCCAGGGGG + Intronic
1122941718 14:104984489-104984511 CAGGAAGGAGCGGGGACAGGAGG + Intergenic
1122960477 14:105091754-105091776 CAGGAATCCGTGGCCCCAGGGGG - Intergenic
1123025369 14:105421362-105421384 CTGGAAGGGGGGTCTCCAGGTGG - Intronic
1123056247 14:105572043-105572065 CCTGGAGAAGGGGCCCCAGGCGG + Intergenic
1123057686 14:105579764-105579786 CCTGGAGAAGGGGCCCCAGGCGG - Intergenic
1123080676 14:105692171-105692193 CCTGGAGAAGGGGCCCCAGGCGG + Intergenic
1123081965 14:105699697-105699719 CCTGGAGAAGGGGCCCCAGGCGG - Intergenic
1123128343 14:105965854-105965876 AAGGTAGGAGGGGCCCAAAGTGG - Intergenic
1202895324 14_GL000194v1_random:3206-3228 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1202903632 14_GL000194v1_random:56525-56547 CAGCATGGAGGGTCCCCAGCGGG - Intergenic
1123421175 15:20138578-20138600 CAGGTAGCTGGGACCCCAGGTGG + Intergenic
1123530400 15:21145114-21145136 CAGGTAGCTGGGACCCCAGGTGG + Intergenic
1123934708 15:25188503-25188525 AAGGAAGGTGTGGCCCCTGGTGG - Intergenic
1124222566 15:27863097-27863119 CAGGAAGGAGAGGCCCCCTGAGG + Intronic
1124346338 15:28923877-28923899 CAGGGATGAGGAGCCCCGGGGGG - Intronic
1124415801 15:29472271-29472293 CAGGAAGAGGTGGCACCAGGAGG + Intronic
1125503486 15:40253377-40253399 CAGGAAGGAGCCAGCCCAGGAGG - Intronic
1125513954 15:40307727-40307749 CAGGAAGGAGGCCAGCCAGGAGG + Exonic
1125672354 15:41483268-41483290 GAGGGAGGAGGGGCCCAATGAGG - Exonic
1125752115 15:42036364-42036386 CTGGGAGCAGGAGCCCCAGGAGG + Intronic
1126370329 15:47939128-47939150 CAGGCAGGGGGAGCCCAAGGAGG + Intergenic
1126484974 15:49170136-49170158 CAGGGAGGAGGAGCCAGAGGAGG + Exonic
1127310398 15:57747028-57747050 AAGGGAGGATGGGACCCAGGGGG + Intronic
1128730244 15:70015828-70015850 CAGGCTGGAGGGGCCCCCTGGGG - Intergenic
1128750478 15:70145397-70145419 CAGCAAGGAGGGGACCCCAGAGG - Intergenic
1129916950 15:79282677-79282699 GAGGAAGGAGGGGGCCGCGGGGG - Intergenic
1129958366 15:79660047-79660069 CAGGAAGGAAGAGTCCCAGTGGG + Intergenic
1130164249 15:81436567-81436589 CAGGAGGCAGGGGCTGCAGGAGG + Intergenic
1131153746 15:90062495-90062517 AAGAAGGGAGGGGCCCCAGTGGG + Intronic
1131632704 15:94196049-94196071 CAGGAAGTAGGGGCTCCAGTTGG + Intergenic
1131665562 15:94567915-94567937 CACTAAGGAAGAGCCCCAGGAGG - Intergenic
1132481823 16:170134-170156 CAGGAAGCAGAAGCACCAGGAGG - Intergenic
1132500014 16:280992-281014 CAAGACAGAGGGGCTCCAGGCGG - Intronic
1132556680 16:575698-575720 CAGGTGGGAGGGGCCCTCGGTGG - Intronic
1132571580 16:646665-646687 CAGGGATGAGCGGCCCCAGCTGG - Intronic
1132647800 16:1007108-1007130 CAGGATGGAGGGGAGCAAGGCGG + Intergenic
1132899698 16:2246506-2246528 CAGGAAGGCGGTCTCCCAGGAGG + Intronic
1132937374 16:2488008-2488030 GGGGCAGGAGGGGCCCCAGCGGG - Intronic
1133212779 16:4272477-4272499 AAGGAAGGAGGGTCCCGGGGCGG + Intronic
1134689686 16:16182985-16183007 GAGGAAGGATGAGCCCCAGACGG + Intronic
1135723424 16:24835990-24836012 CAGGAGGGAGGGGTCACAGAGGG - Intergenic
1136024683 16:27461975-27461997 CAGGAAGCAGCTGCACCAGGGGG + Intronic
1136376997 16:29871595-29871617 CAGGGAGGAGGGCAGCCAGGAGG + Exonic
1136392086 16:29971910-29971932 CAGGAAGGAAGGGACCATGGGGG - Intronic
1136413637 16:30091127-30091149 CAGGTTGGGCGGGCCCCAGGCGG + Exonic
1136417306 16:30112075-30112097 TGGGGAGGAGGGGCCCCTGGAGG + Intronic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1136922999 16:34346719-34346741 CAGGAACCAGAGGCCCCAGCTGG - Intergenic
1136981574 16:35065087-35065109 CAGGAACCAGAGGCCCCAGCTGG + Intergenic
1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG + Intronic
1138355059 16:56371050-56371072 CAGGAATGAGGAGGCCCTGGGGG - Intronic
1139363556 16:66418958-66418980 CAGAAAGGAGAGGCACCAGCCGG + Intergenic
1139921742 16:70464909-70464931 CAGCAAGAAGGTGGCCCAGGTGG + Intronic
1140455710 16:75104472-75104494 CAGGAAGCAGGGGCAGCATGAGG - Intronic
1142117951 16:88369904-88369926 CAGGGAGGTGGGTCCCCAGGAGG - Intergenic
1142133823 16:88442699-88442721 CAGGGAGGAGGCTCCGCAGGAGG + Intergenic
1142165747 16:88586716-88586738 CCAGAAGGTGGGGCCCCAGCTGG - Intronic
1142181900 16:88675293-88675315 CGGGAGGGAGGGGGCCCTGGAGG + Intergenic
1142214613 16:88824470-88824492 CAGGATGGAGAGGCCCATGGGGG + Intronic
1142353734 16:89591389-89591411 CAGGAGGGCGGGGGCCCAGCTGG + Intronic
1142362234 16:89632934-89632956 AAGAAAGGAGGGGCTGCAGGAGG + Intronic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1142766160 17:2065389-2065411 CAGGAAGGAAGGGCTGAAGGAGG - Intronic
1142803536 17:2359811-2359833 CAGGACAGAGGGGCAGCAGGTGG - Intronic
1143019176 17:3907809-3907831 CTGGAGGAAGGGGCCCAAGGAGG - Intronic
1143632498 17:8147137-8147159 CAGGAAGGAGAGGGCAAAGGAGG + Intronic
1143722061 17:8819310-8819332 CAGAAAGTGGGGGCCCAAGGAGG - Intronic
1143783550 17:9241444-9241466 CAGGAAGGCAGGGAGCCAGGAGG - Exonic
1144420919 17:15097825-15097847 CAGGAAGGAGGGGGAAGAGGGGG - Intergenic
1144708287 17:17384324-17384346 CTGGAGGAAGGTGCCCCAGGAGG - Intergenic
1145098765 17:20055819-20055841 CAGAACGGAGGGGGCCCAGTGGG - Intronic
1145738962 17:27255969-27255991 TAGGAGGGAGGGGACCCAGAAGG + Intergenic
1145810351 17:27760582-27760604 CAGGTGGGAGGGGCACCAGGGGG - Intronic
1145816369 17:27797799-27797821 GAGGAAGGATGGGCCCGGGGAGG + Intronic
1146095965 17:29930355-29930377 CACGAAGGAGGAAACCCAGGAGG - Intronic
1146677750 17:34785175-34785197 CAGGATGGTGGTCCCCCAGGAGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146910613 17:36646310-36646332 CCAGATGGAGCGGCCCCAGGTGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147656358 17:42093230-42093252 CAGGAAGCTGGGGCCCGGGGTGG + Intergenic
1147741601 17:42673614-42673636 AAGGTAGGAGAGTCCCCAGGAGG + Intronic
1147948277 17:44092735-44092757 TAGGAGGGAGGCGTCCCAGGGGG + Exonic
1148000092 17:44382818-44382840 GAGGGAGGAGGGAACCCAGGGGG - Intronic
1148190192 17:45672824-45672846 CAGGAACGAGGGGTCCCTGAGGG + Intergenic
1148215078 17:45829906-45829928 CAGGCAGGAAGGGCTCCATGGGG + Intronic
1148228544 17:45916554-45916576 GAGAAAGGAGGGGCCCAAAGAGG + Intronic
1149655647 17:58308477-58308499 CAGCAAGCAGGGCCACCAGGTGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149884646 17:60328066-60328088 CCGGAAGGTGGGGCCTCAGTGGG - Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150484902 17:65536971-65536993 AGGGAAGGAGGGGCCCCCGGCGG - Exonic
1151191184 17:72399334-72399356 GAGGATGGAAGGGACCCAGGAGG + Intergenic
1151253952 17:72860524-72860546 CAGGCAGGTGGGGGCACAGGTGG + Intronic
1151642314 17:75405301-75405323 CAGGAAGGAAGCGCCCCAAAAGG + Exonic
1151716297 17:75832807-75832829 CAGGAAAGAGGGGCCGTGGGAGG + Intronic
1151716328 17:75832897-75832919 CAGGAAGGAGGGGCCGTGGGAGG + Intronic
1152288435 17:79425406-79425428 CAGGCAGTTGGGGCCCCAGGGGG - Intronic
1152607684 17:81301290-81301312 CAGGAAGGGGGAGCACCAGGAGG - Intergenic
1152612736 17:81323542-81323564 GAGGATGGGGAGGCCCCAGGAGG + Intronic
1152730281 17:81966709-81966731 CAGGAAGCAAGGGCCCAAGCTGG + Intergenic
1152742165 17:82023129-82023151 CATGAGGGTGGGGCCCCGGGAGG - Intronic
1152907523 17:82976998-82977020 CAGGGAGTCAGGGCCCCAGGTGG + Intronic
1154309175 18:13254269-13254291 GAGGAGTGAGGGGCCCCAGGTGG + Intronic
1156204380 18:34870359-34870381 CAGGAAGGTGAGGCCCAAGCAGG - Intronic
1156491821 18:37500929-37500951 CAGGCAGGAGAGGCCTCAGCTGG - Intronic
1156983397 18:43320812-43320834 CAGGAGGGAGGGACATCAGGAGG - Intergenic
1157477942 18:48035408-48035430 CAGGATGCAGGGGCTCCAGGAGG + Intronic
1157766073 18:50298531-50298553 CAGGCAGGAGGGACCCCATGGGG - Intergenic
1157766648 18:50302517-50302539 CAGGCAGGAGGGACCCCATGGGG - Intergenic
1158500130 18:57993519-57993541 AGGGAAGCAGGGGCCCAAGGGGG + Intergenic
1158530322 18:58255245-58255267 CAGAAAGGAGTGGCCCCAGCAGG - Intronic
1158556504 18:58479574-58479596 CAGGACGGAGGTGCCACATGAGG - Intergenic
1158624186 18:59057381-59057403 GAGGAAGGAGCGCCCCCATGTGG + Intergenic
1159020075 18:63136081-63136103 CAGGGAGGAGGTGCCCCTGAGGG - Intronic
1159917528 18:74200061-74200083 CAGGCAGGATGGGCCCAAGGAGG + Intergenic
1160078068 18:75696569-75696591 CAGAAGGGAGGGGTACCAGGGGG - Intergenic
1160432050 18:78819260-78819282 CAGGGAGGATGAGCCCCTGGAGG + Intergenic
1160519639 18:79497313-79497335 CAAGGAAGAGCGGCCCCAGGGGG + Intronic
1160709104 19:542619-542641 CTGGAAGGCGGTGCCCCGGGAGG - Intergenic
1160857672 19:1224643-1224665 CAGGCCTGAGGGTCCCCAGGAGG - Intronic
1160968193 19:1755780-1755802 GAGGGAGGAGGGTCCCCAGGGGG - Intronic
1161124866 19:2550204-2550226 CAGCAAGGAGGGTCGCCACGGGG - Intronic
1161497675 19:4596469-4596491 CAGGGAGGAGGGGCCTGGGGGGG + Intergenic
1161558592 19:4958124-4958146 GAGGCAGGTGGGGCCCGAGGAGG - Intronic
1161648714 19:5470814-5470836 CAGGAAGGAGGGGAAGGAGGGGG + Intergenic
1161923070 19:7280916-7280938 AAAGAAAGAGGGGCTCCAGGGGG + Intronic
1162016702 19:7850152-7850174 CAGGAGGGCAGGGCCACAGGTGG + Intronic
1162027147 19:7900832-7900854 CAAGAAGGCGGGGCTCCTGGTGG + Exonic
1162082251 19:8225183-8225205 CAGAGAGGAGGGGAACCAGGAGG + Intronic
1162332444 19:10038602-10038624 CATGAATGAGGAGCCCGAGGTGG - Intergenic
1162565709 19:11445095-11445117 CAGGGAGGTGGGAACCCAGGTGG - Intronic
1162760413 19:12885522-12885544 CAGGAAGGAGGGGGACGTGGCGG + Exonic
1162781539 19:13009527-13009549 CCAGAAGGAGGAGCCTCAGGTGG - Intronic
1162930927 19:13957294-13957316 CAGGAGGGAGGGGGCCCCGGGGG + Intronic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163162303 19:15471870-15471892 CAGGTAGGAGGGGCCCGACCGGG - Exonic
1163425169 19:17236782-17236804 CAGTAAGGAGGGGTCCCAGGGGG + Intronic
1163427116 19:17245809-17245831 CAGGCAGGAGCGGCCGCAGCGGG - Exonic
1163437329 19:17303268-17303290 CGGGGCGGAGGGGTCCCAGGCGG + Exonic
1163631729 19:18421001-18421023 CAGCAGGGAGGGGTCCCATGAGG + Intronic
1163686243 19:18713561-18713583 GAGGGAGGAGGGGCACGAGGAGG - Intronic
1163713412 19:18860411-18860433 CAGGTAGGAGGTGCCCGAGCTGG - Exonic
1164052815 19:21597634-21597656 CAGGGAGGCAGGGCCCCAGCAGG - Intergenic
1164645798 19:29858206-29858228 GAGGAAGGAGGGTGGCCAGGTGG - Intergenic
1165148746 19:33749049-33749071 CAGCAAGGGGGGCCCCCAGCAGG + Intronic
1165179294 19:33954045-33954067 CAGGAGGGCAGAGCCCCAGGTGG - Intergenic
1165246267 19:34500206-34500228 CAGGTTGGAGGCGCCGCAGGTGG - Exonic
1166084488 19:40465936-40465958 CTGGAAGGCGGGGCCACAGAAGG + Intergenic
1166214689 19:41327567-41327589 CAGGAAGCTGGGGCTCCAGCCGG + Intronic
1166218757 19:41352644-41352666 CCGGGAGGGGGGCCCCCAGGGGG - Intronic
1166947196 19:46404526-46404548 CTGGCAGGCAGGGCCCCAGGAGG + Intergenic
1167076974 19:47256271-47256293 CAGGAATGAGGGGCTGGAGGCGG + Intronic
1167129386 19:47574003-47574025 CACGGAGCAGGGGCCCCAGATGG - Intergenic
1167254213 19:48417647-48417669 CTGCAAGCAGGGGCCCCACGTGG - Intronic
1167380319 19:49134533-49134555 CAGGCCTGAGGGGACCCAGGAGG - Intronic
1167606700 19:50485189-50485211 CAGCAAGGTGGGGCCCCACCGGG - Exonic
1167633608 19:50640273-50640295 CAGGCAGGAGTTGGCCCAGGTGG - Intronic
1167676473 19:50889551-50889573 GAGTTAGGAGGGGCCCCAGCTGG - Intergenic
1167676495 19:50889667-50889689 GAGGTAGGAGGGGCCCCAGCTGG - Intergenic
1167773997 19:51542986-51543008 CAGGAAGGAAGGGCAGCAGCAGG - Intergenic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
925579578 2:5397039-5397061 CAGGATGGAGGAGACCCAGGAGG + Intergenic
925971136 2:9107436-9107458 GAAGAAGGATGGGCCCAAGGAGG + Intergenic
926056011 2:9774445-9774467 CAGGAAGGAGGGAGCTCACGCGG + Intergenic
926123553 2:10257612-10257634 CAGGGAGGATGGGCCCGTGGTGG + Intergenic
926164749 2:10514391-10514413 GAGAAAGGTGGGGCACCAGGTGG - Intergenic
926171075 2:10552962-10552984 CAGGAAGGGGCTGACCCAGGGGG + Intergenic
926326907 2:11792878-11792900 CTGGGAGGAGGAGACCCAGGTGG - Intronic
926700710 2:15801340-15801362 CAGGAAGGAAGATGCCCAGGAGG + Intergenic
927174024 2:20392745-20392767 CAAGAAGGTGGGGCTGCAGGAGG + Intergenic
927488360 2:23504553-23504575 CTGGAGGGAGGGGGCACAGGGGG + Intronic
928381389 2:30821702-30821724 CAGGAAAGAAGGGACCCAGGAGG - Intergenic
929559296 2:42945767-42945789 CATGAAGGAAGGGGCCCCGGAGG - Intergenic
929815743 2:45229956-45229978 AAGGAAGGAGGGATCCAAGGAGG - Intergenic
930026238 2:47030707-47030729 CAGGATGGAGGGGGAACAGGCGG - Intronic
930044217 2:47155004-47155026 CAGGAAGGAAGGTCCGCAGGTGG + Intronic
932197517 2:69797243-69797265 CAGGGAGGAGGGGACACAGTAGG + Intronic
932197786 2:69799037-69799059 TAGGGAGGAGGGGCCTCATGAGG + Intronic
933531620 2:83518268-83518290 CAGGCAGGCGGGGCGCCAGCTGG - Intergenic
933722809 2:85409250-85409272 CAGGCTGGAGCAGCCCCAGGAGG + Intronic
934852750 2:97711875-97711897 CAGAAAGGAGGTCCCCAAGGAGG + Intergenic
935715261 2:105933760-105933782 CCAGAAGTGGGGGCCCCAGGAGG - Intergenic
936063361 2:109312525-109312547 CAGGAAGAAGGGGCCCAGCGGGG - Intronic
936560293 2:113532430-113532452 TAGGAGGAAGGGGCCCCAGAGGG + Intergenic
937339243 2:121080379-121080401 CAGAAAGGAGGTGGCCTAGGTGG + Intergenic
937875558 2:126823009-126823031 CAGGGAGGAGGAGCCCCAGGTGG - Intergenic
937916540 2:127101947-127101969 CAGGAAGAAGGTGCCACATGTGG + Intronic
938063823 2:128270564-128270586 CAGGGAGTAAGGGCCCGAGGCGG + Intronic
938261152 2:129895906-129895928 AAGGAAGGATGGGTCTCAGGTGG + Intergenic
938492875 2:131775196-131775218 CAGGGAGGAGGTCACCCAGGTGG + Intergenic
939880108 2:147621603-147621625 AAGGAAGAGGGGGCCCCAGGAGG + Intergenic
941917649 2:170822860-170822882 CAGGGACGAGGAGCCGCAGGCGG + Intronic
946231872 2:218296436-218296458 CTGGAAGGGGTGGGCCCAGGTGG + Intronic
946435435 2:219648888-219648910 CAGGAAGCAGGGGGTTCAGGAGG + Intergenic
947635159 2:231676697-231676719 AAGGCAGGCGGGGCCCCAGAAGG - Intergenic
947878101 2:233480926-233480948 GAGGAAGGAGGGGGACCGGGGGG + Intronic
948181866 2:235988649-235988671 CAGTAATGAGGGGGCCCAGTGGG + Intronic
948239165 2:236414714-236414736 CAGTATGGAGGGGCTCCAGATGG + Intronic
948511172 2:238466275-238466297 GAGGACCGAGGGGCCCCGGGCGG + Intergenic
948750409 2:240129086-240129108 CAGGAAGGAATGATCCCAGGTGG - Intronic
948766392 2:240223724-240223746 AAGGAAGGAGGGTGCCGAGGTGG - Intergenic
948793847 2:240392292-240392314 CAGGCAGGAGGGGCTGTAGGAGG - Intergenic
948886308 2:240886866-240886888 CAGGGAGGAGGTGCTCCAAGAGG + Exonic
949059876 2:241950695-241950717 CTGGCAGCAGGGGCCCAAGGAGG - Intergenic
1168840267 20:905593-905615 CAGGAAGGAGGGTTCCCAGGAGG + Intronic
1168860204 20:1040763-1040785 CAGGTAGGTGGGACCACAGGAGG - Intergenic
1168972532 20:1940393-1940415 AAGGAAAGTGAGGCCCCAGGAGG - Intronic
1169141555 20:3229850-3229872 CAGGGAGAAAGGGCTCCAGGGGG + Intronic
1169193967 20:3673643-3673665 CTGGAAGGCGCGGCCCCTGGGGG + Exonic
1170438360 20:16352804-16352826 GAGGCCTGAGGGGCCCCAGGAGG - Intronic
1170447031 20:16439043-16439065 CAGGAAGGAGGAGGTTCAGGTGG + Intronic
1170878553 20:20273816-20273838 CAGGCAGGTGAGGCCCCAGCAGG - Intronic
1171436354 20:25127591-25127613 GAGGCATGAGGAGCCCCAGGTGG - Intergenic
1172080024 20:32332930-32332952 CAGGAAGGTGGCGACTCAGGTGG + Exonic
1172167294 20:32907100-32907122 CTAGCAGGAGGGGCCCCGGGTGG + Intronic
1172832717 20:37849693-37849715 CACACAGGAGGGGCTCCAGGTGG - Intronic
1173336900 20:42119610-42119632 CAGGAGGGAGAGGCCCAAGCAGG - Intronic
1173626454 20:44476245-44476267 CAGAAAGGATGGGCTCCAGGTGG + Intronic
1173706640 20:45115041-45115063 CAGCCAGGAGGGCCCCCAGGAGG + Exonic
1174400859 20:50275114-50275136 CAGGAAGGAGGAGGCCTGGGTGG - Intergenic
1175226131 20:57444983-57445005 GAGGAGGGAGGGGCAGCAGGAGG + Intergenic
1175532374 20:59682794-59682816 CAGGGAGGAGGAGCCCGTGGTGG + Intronic
1175561193 20:59932835-59932857 CCGCAAGGAGAGGCCGCAGGTGG + Intronic
1175605905 20:60312007-60312029 CAGGAAGGGGAGGCAGCAGGAGG + Intergenic
1175721972 20:61293102-61293124 CAGGATGGTGGGGACCTAGGAGG + Intronic
1175920838 20:62450027-62450049 CAGGATGGATGGGCAGCAGGTGG - Intergenic
1175965532 20:62658352-62658374 CAGGAATTAGGGGCCCAGGGTGG - Intronic
1176093621 20:63329707-63329729 CAGGAAGGAGGAGCTCCTGAGGG + Intronic
1176218240 20:63958186-63958208 CAGGGAGAAGGGGCCCCACTGGG - Exonic
1176297343 21:5081125-5081147 GAGGAAGGAGTGGGCCCTGGAGG - Intergenic
1176310216 21:5145362-5145384 CAGCAAGGAGGGGCCCAGGCTGG + Intronic
1176415465 21:6472058-6472080 CGGGAAGGATGGGCAGCAGGCGG + Intergenic
1176615022 21:9019193-9019215 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1177322632 21:19543045-19543067 AATGAGGAAGGGGCCCCAGGTGG + Intergenic
1177395271 21:20526933-20526955 CAGGAAGGAAGGAAACCAGGTGG - Intergenic
1178661615 21:34511527-34511549 CAGGATGGAGGGGCCACATCTGG - Intergenic
1178664934 21:34538377-34538399 CAGGATGGAGGAGCCCACGGTGG - Intronic
1179437046 21:41369298-41369320 CAGTGAGGAGGGACCCCAGGTGG + Intronic
1179473647 21:41629311-41629333 CAATCAGGAGGGACCCCAGGTGG - Intergenic
1179644746 21:42768601-42768623 GAAGCAGGAGGGGGCCCAGGAGG + Intronic
1179690965 21:43080391-43080413 CGGGAAGGATGGGCAGCAGGCGG + Intergenic
1179708439 21:43195637-43195659 CAGGGAGGAGGGGGCCTAGCAGG + Intergenic
1179768212 21:43590855-43590877 CAGGAAGGAGGGACCACAAAGGG + Intronic
1179846840 21:44116674-44116696 CAGCAAGGAGGGGCCCAGGCTGG - Intronic
1179859686 21:44180823-44180845 GAGGAAGGAGTGGGCCCTGGAGG + Intergenic
1179878661 21:44284414-44284436 GAGGAAGGTGGGGCCAGAGGTGG - Intergenic
1179998073 21:44983064-44983086 CAGGCTGGAGGGGCCGCCGGGGG - Intergenic
1180969609 22:19808290-19808312 CAGAAACCAGGGGCCTCAGGGGG + Intronic
1181013916 22:20057466-20057488 CCGGAAGGATAAGCCCCAGGTGG - Intronic
1181086567 22:20442240-20442262 CTGGGAGGAAGGGCCCCAGCTGG - Exonic
1181105695 22:20573880-20573902 CACGAAGGAGCGACCCCAGTGGG - Intronic
1181442223 22:22942493-22942515 CTGGAAGGAGGGGAGGCAGGAGG - Intergenic
1181539496 22:23565864-23565886 CAGTAAGCAGGTGGCCCAGGAGG - Intergenic
1181545539 22:23600114-23600136 CATGAAGGAGGGACCCTGGGAGG + Intergenic
1181631115 22:24151881-24151903 GAGGAAGGATGGGCCACTGGAGG - Intronic
1182575658 22:31271227-31271249 CAGGAAGGATAGGACCCTGGAGG - Intronic
1183076694 22:35431837-35431859 CTGGAAGGAGGGCCCCCTGGAGG - Intergenic
1183169152 22:36172239-36172261 AACGAGGAAGGGGCCCCAGGTGG - Intergenic
1183408463 22:37641494-37641516 CGGGAAGGAGGGGCCTGAGCAGG + Intronic
1183507780 22:38219056-38219078 CAGGACGGCCGGGCCGCAGGCGG - Intergenic
1183654605 22:39177314-39177336 CAGGCAGGAGGGGCTGCAGTGGG + Intergenic
1183742383 22:39675957-39675979 CAGGCAGCAGGTGCCACAGGAGG + Intronic
1183958774 22:41398303-41398325 CAAGAAGCAGAGGGCCCAGGAGG - Exonic
1184470322 22:44692315-44692337 CTGGGAGGAGGAGCCCCGGGAGG - Intronic
1184470427 22:44692577-44692599 CTGGGAGGAGGAGCCCCGGGAGG - Intronic
1184591984 22:45490994-45491016 AAGGAGGAAGGGGCCCCAGGTGG + Intergenic
1184837569 22:47032923-47032945 GAGGAAGGAGGGGCCACACAGGG - Intronic
1184913206 22:47549760-47549782 CAGGAAGGTGGGGCCCACCGTGG + Intergenic
1184981166 22:48096953-48096975 CAGGGAGGAGGGGCTCCTGCAGG - Intergenic
1185108173 22:48885828-48885850 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1185246686 22:49776572-49776594 CAGGACGGAGATCCCCCAGGTGG - Intronic
1185281531 22:49971969-49971991 CAGGAGGGAGGAGACCCGGGGGG - Intergenic
1185317055 22:50183800-50183822 GGAGAAGGAGGGGCTCCAGGAGG + Intergenic
950015928 3:9754879-9754901 CACCAAGGTGAGGCCCCAGGGGG + Exonic
950650177 3:14402337-14402359 CAGGCAGGAGGCGCCCAGGGCGG + Intergenic
951613982 3:24521904-24521926 GAGGAAGGGCGGGCCGCAGGCGG + Intergenic
953093587 3:39753422-39753444 AAGGAAGGATTGACCCCAGGTGG - Intergenic
953410066 3:42685773-42685795 CCGGAAGTAGGGGCTGCAGGCGG - Exonic
953440018 3:42908876-42908898 CTGGATGGAGAGGCCCCAAGGGG + Exonic
953931307 3:47007215-47007237 CAGGCAGGAGGGGGCAGAGGTGG - Intronic
954807186 3:53227352-53227374 CAGGCAGGGGGAGACCCAGGGGG - Intronic
955041292 3:55320196-55320218 CTGGAAGTAGGGGGTCCAGGTGG + Intergenic
955337780 3:58101203-58101225 CAGGAAGGAGGAACCAGAGGAGG + Intronic
956465979 3:69521123-69521145 CAGTGAGGAGGGACCCCAGATGG + Intronic
956880853 3:73509321-73509343 CAGGAAAGGGCGGACCCAGGAGG + Intronic
957405190 3:79766778-79766800 GAGCAAGAAGGGGCCCCAGAAGG + Intronic
957822942 3:85401483-85401505 GAAGATGGAGGGGCCACAGGAGG + Intronic
958258788 3:91355092-91355114 AAGGTAGGAGGAGCCCAAGGTGG + Intergenic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
958619504 3:96538427-96538449 CAGGAGGGAGTGGCCCCTGGAGG - Intergenic
959497580 3:107069172-107069194 CAGGAAGGTGGATCCCTAGGGGG - Intergenic
960465988 3:117997139-117997161 CAGGGAGGAGGGGGCGCAAGGGG + Intergenic
960601342 3:119462045-119462067 GTGGAAGGAGGGGCCCTAGTCGG - Exonic
961194150 3:124987284-124987306 CAGGGATGAGAGGCCCCAAGAGG + Intronic
961431912 3:126889613-126889635 CAGGAACATGGGGGCCCAGGTGG - Intronic
961537191 3:127577299-127577321 CAGGAAGCTGGGGCCCCGAGAGG - Intronic
961558798 3:127714744-127714766 GAGGCAGGAGGGGACCCGGGTGG + Intronic
961641950 3:128370431-128370453 CTGGGAGGAGGGGCACCAGCAGG + Intronic
961649626 3:128410890-128410912 CGGGAAGGAGGGGGCTCGGGTGG + Intergenic
963065553 3:141260928-141260950 CAGCAGAGAGGGGCCACAGGAGG - Intronic
965178460 3:165367104-165367126 CAGGAAGGAGTGGCGCTAAGTGG + Intergenic
966095756 3:176200800-176200822 CAGCAATGAGGGGCAGCAGGTGG + Intergenic
966095807 3:176201609-176201631 CAGCAATGAGGGGCAGCAGGTGG - Intergenic
967229501 3:187324137-187324159 AATGAGGAAGGGGCCCCAGGTGG + Intergenic
967983673 3:195080233-195080255 TAGGAAGGAAGGGGCCCAGATGG + Intronic
968698196 4:2042696-2042718 CAGGGTGGAGGGGGCGCAGGGGG - Intronic
968853749 4:3102918-3102940 GAGGAATGTGGGGCCCCAGCTGG + Intronic
968902667 4:3438821-3438843 CCGGAAAGAGGGGCCTCAGTAGG + Intronic
969450787 4:7271850-7271872 CAGGAAGGATGGGCCCTGGATGG + Intronic
969505636 4:7585485-7585507 CAGCAAGGTGAGGCCACAGGTGG - Intronic
969542994 4:7805371-7805393 GAGAAAGGAAAGGCCCCAGGGGG - Intronic
969612757 4:8236361-8236383 CACGCTGGAGGAGCCCCAGGAGG + Exonic
971920478 4:32933071-32933093 CAAGAAGGAGGGCCCTCAGCAGG - Intergenic
976939954 4:90687673-90687695 AAGGAAGGAGGGCTCCCAAGGGG - Intronic
983104593 4:163670251-163670273 CAGGAAGAAGGGGCCATGGGGGG + Intronic
983768633 4:171519526-171519548 CTGGAGGGTGGTGCCCCAGGGGG - Intergenic
984485710 4:180366713-180366735 CAGTAGTGAGAGGCCCCAGGGGG - Intergenic
984973454 4:185210026-185210048 CAGGAAGGAGAGGGCCACGGCGG - Intronic
985579816 5:690702-690724 CCGGAGGGAGGGGCCGCAGGGGG - Intronic
985594662 5:782761-782783 CCGGAGGGAGGGGCCGCAGGGGG - Intergenic
985619931 5:948896-948918 CAGTGAGGAGGGGCCCACGGGGG - Intergenic
985650214 5:1104080-1104102 CGGCATGGAGGGGACCCAGGAGG + Intronic
985673340 5:1217684-1217706 CAGGCAGGAGGGGCCCAACAGGG + Intronic
985851058 5:2389394-2389416 CTGGAAGGAGGGGACCAGGGCGG - Intergenic
986677704 5:10201384-10201406 AAGAAAGGAGGGGCCCCTGAGGG + Intergenic
987082593 5:14438926-14438948 AAGGAGGGAGGGGACCCAGAAGG + Intronic
988339790 5:29956049-29956071 CAGGAAGGAAAGGCCACATGAGG - Intergenic
990634699 5:57711577-57711599 CAGGAAGGAGGGTCTTCATGTGG - Intergenic
992646415 5:78815903-78815925 AAGAAAGAAGGGGCCCCAGGAGG - Intronic
996908735 5:128632308-128632330 GAGGAAGGAGGAGCCCAAAGTGG + Intronic
997199008 5:131998476-131998498 CAGGAAGAAAGGGGCCCTGGTGG + Intronic
997823719 5:137088091-137088113 CAGGGAGTAGGGACCACAGGAGG + Intronic
998139212 5:139690448-139690470 CAGGAAGGAGGGAACACAGTTGG - Intergenic
998190424 5:140019231-140019253 CTGGAAGCAGGGGCCACAGAAGG + Intronic
998227132 5:140335795-140335817 CATCAAGGAGAGGGCCCAGGAGG + Intronic
999122176 5:149218028-149218050 GGGGTAGGAGGAGCCCCAGGAGG + Intronic
999126499 5:149250085-149250107 CAGGTAGGAAGGCTCCCAGGTGG - Intronic
999417270 5:151409334-151409356 CAGGCAGGAGGGCCCTCAGGAGG + Intergenic
1000293563 5:159893437-159893459 TTGGAAGGAGGGGCTCCAAGTGG + Intergenic
1000614901 5:163415837-163415859 CAGGCAGGTGGCTCCCCAGGCGG - Intergenic
1000714247 5:164621495-164621517 CTGGAAGGAGGGGCCTCCTGGGG - Intergenic
1001256742 5:170189221-170189243 CAGGTAGGACGGCCCCCAGAGGG - Intergenic
1001679333 5:173544534-173544556 CAGGAAGCAGTGACCTCAGGAGG - Intergenic
1001988082 5:176092947-176092969 TAGGAAGGAGGAGCCCTAAGAGG + Intronic
1002104761 5:176874564-176874586 CAGGTAGGAAGGACCCCAGGGGG + Exonic
1002170404 5:177371292-177371314 CAGGAGGAAGGGGGTCCAGGTGG + Intronic
1002227580 5:177735160-177735182 TAGGAAGGAGGAGCCCTAAGAGG - Intronic
1002228786 5:177745193-177745215 TAGGAAGGAGGAGCCCTAAGAGG - Intronic
1002266560 5:178038590-178038612 TAGGAAGGAGGAGCCCTAAGAGG + Intronic
1002701753 5:181129777-181129799 CAGGAAGGAGGGGGCTGATGTGG - Intergenic
1003263993 6:4550302-4550324 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264024 6:4550380-4550402 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003334652 6:5159173-5159195 CAGGTAGGATGGTCCCCATGGGG + Intronic
1004171324 6:13297569-13297591 CAGCAAGGAGGGGCCCCGTGGGG - Intronic
1005589802 6:27311888-27311910 CTGAAGGGAGAGGCCCCAGGGGG + Exonic
1006152977 6:31999126-31999148 CAGGAGGGAGGCGCCCAAGGTGG + Exonic
1006159285 6:32031863-32031885 CAGGAGGGAGGCGCCCAAGGTGG + Exonic
1006163738 6:32052799-32052821 CAGGGACGGGCGGCCCCAGGTGG - Intronic
1006164856 6:32058187-32058209 CAGGGACGGGCGGCCCCAGGCGG - Intronic
1006165349 6:32061526-32061548 CAGGGACGGGCGGCCCCAGGTGG - Intronic
1006166307 6:32067790-32067812 CAGGGACGGGCGGCCCCAGGTGG - Intronic
1006173733 6:32109645-32109667 CAGAGAGGAGGGGCAGCAGGTGG - Intronic
1006304665 6:33211814-33211836 CAGGAAGCAGGGGAGCCAGGAGG + Exonic
1006565912 6:34956976-34956998 CAGGGATTAGGGGCACCAGGTGG - Intronic
1006788653 6:36684477-36684499 CAGGCTGAAGGGTCCCCAGGTGG + Exonic
1006929826 6:37680969-37680991 GAGGAAGGGTGGGCCCCAGTAGG - Intronic
1007167791 6:39841069-39841091 CTGGGAAGAGGGGCTCCAGGGGG + Intronic
1007395544 6:41575746-41575768 CAGCAGGGAGGGGCTCCTGGGGG - Intronic
1007716501 6:43859114-43859136 CAGGAAGGAGAGGCCCAGAGAGG - Intergenic
1008537174 6:52515235-52515257 CAGGAAGGTAGAGCTCCAGGTGG + Intronic
1009184982 6:60564272-60564294 AAGGTAGGAGGAGCCCAAGGTGG - Intergenic
1011559401 6:88599564-88599586 CGGGAAGGGGGGGCACCAGAGGG + Intergenic
1013274587 6:108572066-108572088 CAGTAAGGAGGGGGACTAGGGGG - Intronic
1013488260 6:110618662-110618684 AAGGAGGAAGGGGCTCCAGGTGG + Intronic
1013621044 6:111889480-111889502 CAAGGAGGAGGGGCTCCAGCTGG + Intergenic
1013775393 6:113673622-113673644 GTGGAAGGAGGGGCCCCTGGAGG + Intergenic
1013992045 6:116265174-116265196 GTGGAAGGAGTGGCCCCAGATGG + Intronic
1014777197 6:125524734-125524756 CAGGAAAGAGGGGCCACTGTGGG + Intergenic
1015622003 6:135141240-135141262 CAGCAAGCAGGGGCAGCAGGCGG + Intergenic
1016435601 6:144034210-144034232 CTGGAATGAGGCACCCCAGGAGG - Intronic
1018544884 6:164924543-164924565 CAGCAAGCAGGGGCTGCAGGAGG + Intergenic
1019277552 7:183869-183891 CAGGACAGAGGGGCCCGGGGAGG - Intergenic
1019287175 7:229455-229477 CAGGCAGGAGGGGCCCCATTGGG - Exonic
1019385469 7:753299-753321 CAGAAAGGAGCGGGCACAGGCGG + Intronic
1019558018 7:1642154-1642176 CAGGAGTGAGAGGCCCCAGGTGG + Intergenic
1019738816 7:2662920-2662942 CAGGCAGGTGCTGCCCCAGGAGG + Exonic
1019812543 7:3175205-3175227 GAGGAGGCAGGGGCCCCGGGAGG - Intergenic
1021958924 7:25853004-25853026 CAGTAAAGGCGGGCCCCAGGTGG - Intergenic
1022418161 7:30196007-30196029 AATGAGGAAGGGGCCCCAGGTGG - Intergenic
1022535373 7:31095395-31095417 CTGGAAGAAGAGGCCCCTGGTGG + Intronic
1022536525 7:31101994-31102016 AAGGAAGGAGGAGACACAGGGGG - Intronic
1023108206 7:36784073-36784095 TAGGAAGGTGGGCCCCAAGGTGG - Intergenic
1023789983 7:43746262-43746284 CAGGAAGGAAGGGGGCCATGGGG + Intergenic
1024591966 7:50894595-50894617 GAGGAAGGAGGAGCCACAAGAGG + Intergenic
1024613309 7:51085405-51085427 CCGGAAGGTGGTGCTCCAGGAGG + Intronic
1025175904 7:56802357-56802379 GAGGAAGGAGGTGGGCCAGGAGG + Intergenic
1025695889 7:63774065-63774087 GAGGAAGGAGGTGGGCCAGGAGG - Intergenic
1025898746 7:65726728-65726750 CAGGAGGGATGGGGCCTAGGGGG - Intergenic
1026006197 7:66602114-66602136 AAAGAAGGAGAGGCCACAGGTGG + Intergenic
1026411275 7:70125679-70125701 CGGGTAGGAGGTGACCCAGGTGG - Intronic
1026896862 7:74014296-74014318 CAGATGAGAGGGGCCCCAGGAGG - Intergenic
1027416104 7:77976319-77976341 AATGAGGAAGGGGCCCCAGGTGG - Intergenic
1027421181 7:78019569-78019591 CGGGAAGGAGGCGCCCCGTGCGG - Exonic
1027686019 7:81279595-81279617 GAGGAAGGAGGAGCCCAAAGTGG - Intergenic
1028222963 7:88218923-88218945 CAGTATGGAGGGGCTCCCGGAGG - Exonic
1028773992 7:94657961-94657983 CTGGGAGGAGGGGCCTGAGGAGG - Intronic
1028807312 7:95043448-95043470 CAAGGAGGAAGGGCCCCAGATGG + Intronic
1029166626 7:98595968-98595990 CAATAAGGAGGGGCCCAGGGTGG - Intergenic
1029422285 7:100477827-100477849 CGGGAGGAAGGGGCCCCAGGTGG + Exonic
1029443877 7:100602480-100602502 CAGTGAGGAGGGGCCCCAGGAGG - Exonic
1031122741 7:117739807-117739829 CAGGAATGCAGGGCCCAAGGAGG + Intronic
1032020333 7:128404256-128404278 CAGCATGGAGGGACCCCAGGGGG + Intronic
1032076460 7:128838427-128838449 CGGGTAGGACGGGCCCCAGGGGG + Exonic
1032112126 7:129085070-129085092 CAGGAAGAAGGGATCACAGGAGG - Intergenic
1032165660 7:129542758-129542780 CAGAAAGTATGGGCCCCAGAGGG - Intergenic
1032193477 7:129777439-129777461 CAGGATGGAGAGGCCCCAGCGGG - Intergenic
1032490635 7:132321653-132321675 CAGGCAGGAGGGAGCCCCGGGGG + Intronic
1032964384 7:137079160-137079182 CAGGAAGGCAGGGCTCAAGGAGG - Intergenic
1033159048 7:138981128-138981150 CAGGAAGCAGCAGCCCCGGGCGG + Exonic
1034437680 7:151070924-151070946 CAGGAAGCAGGGCCCAGAGGAGG - Intronic
1035274323 7:157738292-157738314 CGGGAAGGAGGCGCCCCAGAGGG + Intronic
1035569983 8:666521-666543 GAGAGAGGAGGGGCCCCAGCAGG - Intronic
1035780621 8:2224483-2224505 CAGGAAGGAGGGGCCCAGTGTGG + Intergenic
1038040554 8:23720544-23720566 CAGGCAGGAGGGGGACCCGGGGG + Intergenic
1038420969 8:27433867-27433889 CAGGAAGCAGGGGTCACAGCTGG + Intronic
1040550033 8:48430514-48430536 CAGGAAGCAGGGGACCCTGGAGG - Intergenic
1040850950 8:51899613-51899635 CAGGCAGGGCGGGGCCCAGGCGG - Intergenic
1041636652 8:60153091-60153113 CAGGGAGGAGGGGACAGAGGAGG + Intergenic
1042792568 8:72624824-72624846 CAGCAAGGAGAGGCTCCAGCAGG - Intronic
1042835050 8:73072116-73072138 GAGGAAGGAGAGGGGCCAGGAGG + Intronic
1043392069 8:79801424-79801446 CAGGAAGGAGGGTCCTCACCAGG + Intergenic
1044544455 8:93444174-93444196 CAGAAGGGAGACGCCCCAGGAGG + Intergenic
1044728148 8:95209384-95209406 CAGGAGGGAGCAGCCCCAGGAGG - Intergenic
1045341388 8:101257669-101257691 GAGGCATGAGGGGCCTCAGGTGG - Intergenic
1045524458 8:102929958-102929980 CTTGGAGGAGGGGCCCCACGGGG + Intronic
1045810625 8:106216127-106216149 CAGGAGGGAGGGGCCTCATGAGG - Intergenic
1046422784 8:114006483-114006505 CAGGAAGCATGGCCCCAAGGTGG + Intergenic
1047706437 8:127504414-127504436 TAGGCAGGAGGGGGCCCAGCAGG + Intergenic
1047724214 8:127670297-127670319 CAGGAAGCAGGGAGGCCAGGAGG - Intergenic
1047841183 8:128754884-128754906 CAGGATCGAGGGACCCCAAGAGG - Intergenic
1048329988 8:133464748-133464770 CAGCGAGGCGGGGCCACAGGAGG + Intronic
1049058091 8:140254644-140254666 TAGGCTGGAGGGGCACCAGGAGG - Intronic
1049174994 8:141186805-141186827 CAGGCAGGAGGGGCCGCTGGGGG - Intronic
1049202667 8:141349397-141349419 CAAGATGGAGGGGCCCCATGTGG - Intergenic
1049218295 8:141417671-141417693 GAGGAAGGAGGGGTCCCGGGCGG + Intronic
1049224213 8:141441912-141441934 CAGGAGGGAGTAGCCCCAGGGGG - Intergenic
1049237026 8:141517568-141517590 GAGGGAGGTGCGGCCCCAGGAGG - Intronic
1049412489 8:142479484-142479506 CAGGTAGGAGGGGCCTCACCGGG - Exonic
1049558188 8:143294091-143294113 CAGCCAGGAGGGGCAGCAGGAGG - Intronic
1049796978 8:144501359-144501381 CAGGCAGGAGGGGGTCCAAGCGG - Intronic
1049824916 8:144662235-144662257 GAGGAAGGAGGGGTTCAAGGTGG - Intergenic
1049824998 8:144662520-144662542 GAGGAAGGAGGGGTTCAAGGTGG - Intergenic
1049892573 9:83928-83950 TAGGAGGAAGGGGCCCCAGAGGG - Intergenic
1051364316 9:16310390-16310412 CAGGGAAGAGGGGCCCCAGCTGG - Intergenic
1053157471 9:35791332-35791354 ATGGAAGGAGGGGCGGCAGGGGG + Intergenic
1053313760 9:37035554-37035576 GAGGAAAGGGGGGCCCCCGGCGG + Intergenic
1053647158 9:40130376-40130398 CAGGGAGGAGGTCACCCAGGTGG + Intergenic
1053733804 9:41083983-41084005 TAGGAGGAAGGGGCCCCAGAGGG - Intergenic
1053758567 9:41333467-41333489 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1054537422 9:66245794-66245816 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1054694605 9:68347569-68347591 TAGGAGGAAGGGGCCCCAGAGGG + Intronic
1055657330 9:78464275-78464297 CAGGAAACAGGGGTCCCAAGAGG - Intergenic
1057604538 9:96489567-96489589 TGGGAAGGAGGGGCCACAGGAGG - Intronic
1058756516 9:108087823-108087845 CAGGAAGGGTAGACCCCAGGTGG + Intergenic
1059362215 9:113753729-113753751 CAGGAAAGAGGGCTTCCAGGAGG + Intergenic
1059416982 9:114168403-114168425 CAGCAGGCAGGGGACCCAGGGGG + Exonic
1060196847 9:121629418-121629440 CAGGAAGAAAGGGCGCCATGAGG - Intronic
1060422615 9:123480199-123480221 CTGGAAGCAGGGGCCCTGGGAGG - Intronic
1061232747 9:129324352-129324374 CAGGAGGGCGGGGTCCCAGGAGG + Intergenic
1061275633 9:129568345-129568367 CAGTAAGCAGGTGGCCCAGGAGG - Intergenic
1061433016 9:130543172-130543194 CTGGTGGGAGGGGCCCAAGGGGG + Intergenic
1061669813 9:132182447-132182469 CTGGAAGGAGGAGGCCCAAGTGG + Intronic
1061847300 9:133394908-133394930 CAGGAAGGAGGGGAGGCAGAGGG + Intronic
1061865163 9:133488270-133488292 CAGGGAGCAGGGGCCCCTTGGGG + Intergenic
1061920231 9:133778621-133778643 CAGGGAGGAGGAGGCACAGGGGG - Intronic
1061920466 9:133779766-133779788 CAAGAGGGAGGGGGCCCAGATGG + Intronic
1062070153 9:134551061-134551083 CAGGAGGGAAGGGGGCCAGGTGG + Intergenic
1062070679 9:134553560-134553582 CAGGAAGCGGGGAGCCCAGGAGG - Intergenic
1062086482 9:134651747-134651769 CGGGACAGAGGGGCCCCTGGGGG + Intronic
1062284677 9:135767773-135767795 CAGGTAGGAGGGGCATCAGGAGG - Intronic
1062294401 9:135816402-135816424 AGGGAAGGAGGGGCCACAGCAGG + Intronic
1062346039 9:136115797-136115819 CAGGTGGGAGGGGCCTCAGCAGG - Exonic
1062426578 9:136508823-136508845 CCCGAAGGAGGGGCCCTGGGTGG - Intronic
1062537228 9:137026405-137026427 CAGGAAAGTGGGGACCCAGCAGG + Intronic
1062543269 9:137050886-137050908 CAGGGTGGAGGGGCACCTGGAGG + Exonic
1062552531 9:137096299-137096321 CCTGAAGGATGGGACCCAGGAGG + Exonic
1062633604 9:137478460-137478482 CAGGATAGAGGGACCCCAGTGGG - Intronic
1062648781 9:137564877-137564899 CGGGAAGGTGAGTCCCCAGGAGG - Exonic
1203778996 EBV:90346-90368 CGGTAAGGAGGGGCTCAAGGAGG - Intergenic
1203746185 Un_GL000218v1:41721-41743 CAGCATGGAGGGTCCCCAGTGGG - Intergenic
1185469935 X:376317-376339 CAGGACGCAAGGGCTCCAGGGGG - Intronic
1185483946 X:468255-468277 CAGGAAGGAGGGGCAACAGCAGG - Intergenic
1186435415 X:9538884-9538906 CTGAGAGGAGGGGCCCCAGCGGG - Intronic
1187427123 X:19188046-19188068 AATGAGGAAGGGGCCCCAGGTGG - Intergenic
1187472612 X:19582434-19582456 GAGGAAGGAGGGGCCGGAGTTGG - Intronic
1189497132 X:41518968-41518990 GAGGAAGGAGAGACCACAGGTGG + Intronic
1189628190 X:42921597-42921619 CTGGAATCAGGGGCCCCAGGAGG - Intergenic
1189724541 X:43954990-43955012 GAGGAAGGAGGGGCTGGAGGGGG - Intronic
1190063627 X:47226040-47226062 CAGGAAGCAGGGGCACAAGGGGG + Intronic
1190266292 X:48829167-48829189 CTGGAAGGAAGGGCTCCATGTGG - Exonic
1193640211 X:84003211-84003233 GAGGAGGGAGGGGTCCCAAGGGG - Intergenic
1197520376 X:127490047-127490069 CAGGACTCAGGGACCCCAGGAGG + Intergenic
1197548770 X:127861937-127861959 CAGGCAGCTGGGGCTCCAGGCGG - Intergenic
1197782585 X:130172341-130172363 CAGGAAGGGTGGGACCCGGGAGG + Intronic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1199175861 X:144786557-144786579 CAGGAGGGAGGAGCACCAAGTGG + Intergenic
1200034662 X:153319618-153319640 CTGCACGCAGGGGCCCCAGGAGG - Intergenic
1200045276 X:153397589-153397611 CTGCACGCAGGGGCCCCAGGAGG - Intergenic
1200047487 X:153410525-153410547 CAGGGAGCAGGGCCCCCAGGGGG - Intergenic
1200089197 X:153626441-153626463 CAGGGAGCAGGGCCCCCAGGGGG + Intergenic
1200224750 X:154411416-154411438 CAGGAAGCGGGAGCCCCACGGGG + Intronic
1201159511 Y:11156734-11156756 CAGCATGGAGGGTCCCCAGCGGG - Intergenic