ID: 1083665459

View in Genome Browser
Species Human (GRCh38)
Location 11:64271745-64271767
Sequence GTCCTCCGTCCCCGCGGGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083665449_1083665459 -4 Left 1083665449 11:64271726-64271748 CCTCCCCCATCCCTTCGTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 492
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665451_1083665459 -8 Left 1083665451 11:64271730-64271752 CCCCATCCCTTCGTCGTCCTCCG 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665440_1083665459 29 Left 1083665440 11:64271693-64271715 CCGAGCGCGAGCGGCCCCGAAAG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665446_1083665459 15 Left 1083665446 11:64271707-64271729 CCCCGAAAGGGGCTGGGCTCCTC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665452_1083665459 -9 Left 1083665452 11:64271731-64271753 CCCATCCCTTCGTCGTCCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665447_1083665459 14 Left 1083665447 11:64271708-64271730 CCCGAAAGGGGCTGGGCTCCTCC 0: 1
1: 2
2: 4
3: 32
4: 224
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665450_1083665459 -7 Left 1083665450 11:64271729-64271751 CCCCCATCCCTTCGTCGTCCTCC 0: 1
1: 0
2: 5
3: 57
4: 700
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665453_1083665459 -10 Left 1083665453 11:64271732-64271754 CCATCCCTTCGTCGTCCTCCGTC 0: 1
1: 0
2: 1
3: 22
4: 417
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1083665448_1083665459 13 Left 1083665448 11:64271709-64271731 CCGAAAGGGGCTGGGCTCCTCCC 0: 1
1: 0
2: 2
3: 26
4: 217
Right 1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083665459 Original CRISPR GTCCTCCGTCCCCGCGGGGT AGG Exonic
906471214 1:46132714-46132736 GTCCCCCCTCCCGGCGCGGTTGG - Intronic
912562557 1:110561079-110561101 GCCCTCCAGCCCCGTGGGGTAGG + Intergenic
912924919 1:113905344-113905366 GGCCTCCGCTCCCGCGCGGTTGG + Exonic
915105622 1:153533604-153533626 GTCTTCTGTCCCCACTGGGTGGG - Intergenic
917869640 1:179229748-179229770 GCCCTCCTTCCCCGCGGCGGAGG - Intergenic
922730857 1:227948128-227948150 TTCCTCCATCCCCGCCGGGCAGG - Intergenic
924502884 1:244653253-244653275 GGCCTCCGGCCCCGCGGAGACGG + Exonic
1064183706 10:13141806-13141828 GCCCTCCTTCCCCGCCGGGAAGG - Intergenic
1064288116 10:14010519-14010541 CTCCCCAGTCCCCGCGGAGTAGG + Intronic
1068762984 10:60733278-60733300 GTCCTCGGTGCCCGCGGGAGAGG + Intronic
1070570442 10:77636909-77636931 TTCCTCCGTCCCCGCTGAGTTGG + Intronic
1073076368 10:100827685-100827707 GTCCTCCCTCCCTCCGGGGTGGG - Exonic
1074015575 10:109530546-109530568 GTCCTCTGTCCCTGTGCGGTGGG - Intergenic
1078729604 11:13963198-13963220 CTCCTCCGGCACCGCGAGGTCGG - Intronic
1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG + Exonic
1083886286 11:65574857-65574879 GTTCTCAGTCCCAGCGGTGTGGG - Intergenic
1089543745 11:119206551-119206573 GTCCACCGTCCCCGGCGGGTGGG - Exonic
1112560282 13:100506653-100506675 GTCCTCAGTCCCCCCCAGGTTGG - Intronic
1112808354 13:103187683-103187705 CTCCACCGTCTCCTCGGGGTGGG - Intergenic
1113946975 13:114049920-114049942 GGCCTCCGACCCCGCGGCATGGG - Intronic
1122577215 14:102750030-102750052 GGCCTCGGTCCCCGCGGCCTCGG + Intergenic
1129600426 15:76995265-76995287 GTCCTCCATCACCGCAGGGTCGG + Exonic
1130224558 15:82046989-82047011 GGCCTGCGTCCCCGCGGTGGCGG - Intergenic
1131054779 15:89368802-89368824 GGCCTCCCTCCCCGACGGGTCGG + Intergenic
1132865164 16:2089705-2089727 GTCCTCCTTCCTGGCGGGGGTGG - Exonic
1138350712 16:56344973-56344995 GTCCTCTGTCCCCAGGGGCTGGG - Exonic
1142977788 17:3655995-3656017 GTCCTCCTTCCCCGTGGCCTGGG + Intronic
1144016907 17:11204852-11204874 GTCCTCTGTCCCCGCCAGCTTGG + Intergenic
1145970002 17:28951002-28951024 CTCCCCCCTCCCCCCGGGGTTGG - Exonic
1147731923 17:42609457-42609479 GTCCTCCCTCCCCTCTGGGTGGG - Intronic
1148245055 17:46025033-46025055 TTCCTCCCTCCCTGCAGGGTAGG + Exonic
1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG + Exonic
1151854376 17:76710728-76710750 CTCCTCCGGCCCCGCGGGCGAGG + Exonic
1152593797 17:81228530-81228552 CTCCCCCGTCCCATCGGGGTGGG - Exonic
1156469816 18:37370235-37370257 CTCCTCCTTCCCCTCGGGCTCGG - Intronic
1159056371 18:63468797-63468819 GTCCTCCCTTCCCATGGGGTGGG + Intergenic
1161027672 19:2044152-2044174 GTCCTCTTTCCCCACAGGGTGGG + Intronic
1161084580 19:2328892-2328914 ATCCGCCGTCCCCGCGTTGTCGG + Intronic
1161152694 19:2717930-2717952 CTCCTCCCTCCCCGGGGCGTGGG - Intronic
930993243 2:57685523-57685545 GTTCTCCGGCCCCTGGGGGTTGG - Intergenic
932105403 2:68936973-68936995 TTCCTCATTCCCCGAGGGGTAGG - Intergenic
932451977 2:71816926-71816948 CTCCTCAGTCCCCAGGGGGTGGG + Intergenic
932780039 2:74554092-74554114 GTCCTCCCTCCCCGTGGAGCTGG + Exonic
936278351 2:111119140-111119162 CTCCGCGCTCCCCGCGGGGTCGG - Intergenic
941104884 2:161341108-161341130 CTCCTCCGGCCCCGCGGGCGAGG + Intronic
943105776 2:183544108-183544130 GTGCTCCGTCCCCGGGAGATGGG - Intergenic
947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG + Intronic
1170889101 20:20364300-20364322 GTCGTGCGTCCTCGCGGGGAGGG - Intergenic
1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG + Intronic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
954330830 3:49889465-49889487 GTCCTCAGTGCCTACGGGGTGGG - Intronic
956175746 3:66471561-66471583 GCCCTCCGTCCCTGCTGGTTGGG - Intronic
961741058 3:129033357-129033379 GTCCTCGGTCCCCATGGGGGTGG - Intronic
964049443 3:152372916-152372938 GTCCTCTGTCCCAGAGAGGTGGG + Intronic
967884755 3:194325827-194325849 GCCCTCTGTCCCCTCGGGGAAGG - Intergenic
984952832 4:185019560-185019582 GTCCTCTGTGTCCGCGGGCTCGG - Intronic
987050469 5:14143764-14143786 GTCCTCCGGCCCCGCCGCGGCGG + Exonic
989388727 5:40878728-40878750 GTCCTCCCTCCTCAAGGGGTGGG - Intergenic
989731876 5:44658711-44658733 GTCCTACTTCCCTGCTGGGTTGG + Intergenic
990253092 5:53937121-53937143 GTTCTCCGTCCCCGGAGGCTCGG + Intronic
990544977 5:56814490-56814512 GTCCTTCTTCCCTGCAGGGTCGG - Intergenic
992672013 5:79070120-79070142 ATCCTCGCTCCCCGCGGGGCTGG - Intronic
998228904 5:140346734-140346756 CTCCGCCGCGCCCGCGGGGTCGG - Intergenic
999326936 5:150649594-150649616 CTCCTCCGCCGCCGCGGGGCTGG - Exonic
1002189958 5:177473095-177473117 GTCCCCCGGGCCCGGGGGGTAGG + Exonic
1005851728 6:29827968-29827990 GTCCTGCGCCCCCGCCGGGCCGG - Intronic
1005859104 6:29887875-29887897 GTCCTGCGCCCCCGCCGGGCGGG - Intergenic
1005931695 6:30489646-30489668 GTCCTTCGCCCCCGCCGGGCCGG - Intronic
1009905490 6:69866482-69866504 GTCCTCTGTCCTCGCGGAGTGGG + Intergenic
1017964676 6:159253901-159253923 GACCTCCGTCCCCTCTGGGGTGG + Intronic
1019330947 7:460550-460572 TTCCTCTGTCCCCGCGGGGGAGG - Intergenic
1019795213 7:3043746-3043768 GCCCTCCGTCCCCCCGGGCCCGG + Exonic
1022897354 7:34764694-34764716 GGCCTCCGTCCCCAAGGGATAGG - Intronic
1028370563 7:90087244-90087266 GTCCTCTGGCCCCTTGGGGTTGG - Intergenic
1028481666 7:91313306-91313328 GTCCTCCGGCCCCTGGGGCTGGG + Intergenic
1029055232 7:97733620-97733642 GTACTCCGGCCCCGAGGCGTGGG - Intronic
1033946761 7:146728097-146728119 GTCCTCCGTCTCTGCAGGTTCGG - Intronic
1044306405 8:90645754-90645776 GACCGCCTTCCCCGCGGGGGCGG - Exonic
1048999650 8:139816523-139816545 CTCCTCTGTCCCCTCTGGGTCGG - Intronic
1049239305 8:141528836-141528858 GTCCTGAGTCCCCCCGGGCTGGG - Intergenic
1057489152 9:95508378-95508400 AGCCTCCGTCCCCGCGGCGGCGG - Exonic
1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG + Intronic
1061541070 9:131278016-131278038 GACCTGCATCCCCGCGGGGCCGG - Intergenic
1197350093 X:125372371-125372393 GTCCTCCGTCCCAGGGAGATGGG + Intergenic
1200078101 X:153561840-153561862 GTCCAGCGTGCCCGCAGGGTGGG + Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic