ID: 1083667512

View in Genome Browser
Species Human (GRCh38)
Location 11:64284055-64284077
Sequence AAACTGGGGCTCTGAGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 10, 3: 73, 4: 458}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083667507_1083667512 17 Left 1083667507 11:64284015-64284037 CCTACAATGGTGGTTATTAATTG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG 0: 1
1: 0
2: 10
3: 73
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083667512 Original CRISPR AAACTGGGGCTCTGAGAGTT TGG Intronic
900074360 1:801075-801097 AAAATGGGGCCCAGAGAGATGGG - Intergenic
900831948 1:4971778-4971800 AAACTGAGGCTCAGAGGGTCCGG + Intergenic
901488175 1:9579810-9579832 AGACAAGGGCTATGAGAGTTAGG + Intronic
901760463 1:11467961-11467983 ACACTCGGGCTCCAAGAGTTGGG - Intergenic
901782505 1:11603057-11603079 AAACTGAGGCCCAGAGAGCTTGG + Intergenic
901788537 1:11640903-11640925 AAACCGAGGCTCAGAGAGGTGGG - Intergenic
901872836 1:12148206-12148228 AAACTGAGGCTCGGGGAGTGGGG + Intergenic
902200102 1:14826948-14826970 ACACTGGGACTCGGAGAGCTTGG - Intronic
902450515 1:16493989-16494011 AAACTGAGGCTCAGAGAGATTGG + Intergenic
902502344 1:16919353-16919375 AAACTGAGGCTCAGAGACATTGG - Intronic
902620531 1:17648272-17648294 AAATTGAGGCTCAGAGAGTTGGG + Intronic
902882102 1:19378902-19378924 AAAGTGAGGCTCAGGGAGTTGGG - Intronic
903306983 1:22419855-22419877 AAACTGAGGCCCAGGGAGTTTGG + Intergenic
903386814 1:22932416-22932438 AAACTGAGGCTCACAGAGATGGG + Intergenic
903733647 1:25516427-25516449 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
904826106 1:33274819-33274841 AAACTGAGGCTCAGAGAGAGGGG - Intronic
904830734 1:33305045-33305067 AAACTGGGGCCCTGAGAGACTGG - Intergenic
905489108 1:38329619-38329641 AAATTGAGGCTCTGGGAGGTTGG + Intergenic
905672349 1:39799910-39799932 GAACTGGGGCTCAGAGGGATGGG - Intergenic
905729365 1:40285976-40285998 GAACTGGGGCACTGGAAGTTGGG + Exonic
905946193 1:41903337-41903359 AAACTGAGGCACAGAGAGTCTGG - Intronic
907130162 1:52090208-52090230 AAACTGAGGCTCAGAGAGCAAGG - Exonic
907301111 1:53486822-53486844 AAACTGGGGCTGGGAGAGCCTGG + Intergenic
907386133 1:54126440-54126462 AAACTGAGGCACAGAGAATTTGG - Intergenic
908747609 1:67391135-67391157 AAACTTGGGCTCAGATAGTTGGG - Intronic
909338731 1:74507789-74507811 GAACATGGGCTCTGAGACTTAGG + Intronic
909426503 1:75531562-75531584 TAAGGTGGGCTCTGAGAGTTGGG + Intronic
909499283 1:76315724-76315746 AAATTGGGGCTCTGAGGTTAAGG - Intronic
909601499 1:77466115-77466137 AGGCTGGGGCTCAGAGAGCTGGG - Intronic
913136652 1:115897264-115897286 AAACTGGTTCTCTAAGAGTACGG + Intergenic
915364864 1:155309420-155309442 AAACTGAGGCTCTAGGAGGTAGG - Intronic
916188477 1:162156302-162156324 AAACTGAGGCTCAGAGGGGTAGG + Intronic
917165847 1:172112281-172112303 TAACTGGGGCACAGAGAGGTTGG + Intronic
917488163 1:175474220-175474242 ATTCTGAGGTTCTGAGAGTTAGG - Intronic
917517087 1:175717183-175717205 AAACTTTGGCTGTGAGACTTTGG + Intronic
918103697 1:181398476-181398498 AAACTGAGGCCCAGAGAGGTTGG + Intergenic
919834383 1:201563617-201563639 AAACTGAGGCTCAGAGAAGTGGG - Intergenic
922235829 1:223721789-223721811 AAACTGAGGCTCAGAGGGGTTGG - Intronic
922270209 1:224025979-224026001 AAAATGGGGCCCAGAGAGATGGG - Intergenic
922526889 1:226310572-226310594 AAACTGAGGCACAGAGAATTCGG - Intergenic
922923899 1:229331529-229331551 GAACAGGGGCTATGGGAGTTAGG - Intronic
1062769593 10:88258-88280 AAACTGAGGCTCAGAGACCTGGG + Intergenic
1063071759 10:2672964-2672986 TTCCAGGGGCTCTGAGAGTTGGG - Intergenic
1063458439 10:6201391-6201413 GAACAGGGGCTCTGAGAGGGCGG + Intronic
1064686564 10:17867786-17867808 AAACTTGGGCTCTAAGAGCATGG - Intronic
1065805260 10:29388266-29388288 AAAGTGCGGCTCTGAGAGTTAGG - Intergenic
1065943824 10:30588952-30588974 AAAGTGCGGCTCTGAGAGTTAGG + Intergenic
1067288664 10:44925609-44925631 AAACTGAGACTCAGAGAGATTGG + Intronic
1068384459 10:56307362-56307384 GAACTAGGTCTCAGAGAGTTGGG + Intergenic
1068754639 10:60637973-60637995 AAACTGGCTCTCAGAAAGTTGGG - Intronic
1070305493 10:75236544-75236566 AAACTGAGGCTCAGAGAGACTGG - Intergenic
1070536469 10:77381844-77381866 CAAGTGGGGCTCTGAGAGCAAGG + Intronic
1072736063 10:97880490-97880512 AAACTGAGGCTCTGCGAGGAAGG - Intronic
1072744474 10:97930130-97930152 AAACAGGGGCTCAGAGGCTTAGG + Intronic
1073074815 10:100817260-100817282 AAACTGAGGCTCAGAGAGAGGGG - Intronic
1074096642 10:110319065-110319087 AGAGTGGCTCTCTGAGAGTTAGG - Intergenic
1075069411 10:119310840-119310862 AAACTGTGGTTCAGAGAGGTTGG + Intronic
1075684103 10:124352055-124352077 AAACTGAGGCTCAGAGAGGTTGG - Intergenic
1076413678 10:130269890-130269912 AGACTGGAGCTCTAAGAGTTAGG - Intergenic
1076493881 10:130884240-130884262 AAAATGAGGCTCTAAGAGTTTGG - Intergenic
1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG + Intronic
1077031655 11:470923-470945 AAACTGGGCCTGTGAGATATGGG + Intronic
1077500779 11:2909022-2909044 AAACTGAGGCCCTGAGAGGAGGG + Intronic
1077501087 11:2909986-2910008 AAACTGAGGCCCTGAGAGGAGGG + Intronic
1077908921 11:6557780-6557802 AAGTTGGGGGTCTCAGAGTTAGG - Exonic
1078490451 11:11763133-11763155 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1078755026 11:14200996-14201018 AAACTGAGGCTCAGAGAGGTAGG - Intronic
1080468760 11:32524945-32524967 AAACTAAGGTTCAGAGAGTTGGG + Intergenic
1080665270 11:34330332-34330354 AAACTGAGGGTCAGAGAGATTGG - Intronic
1081466896 11:43328423-43328445 GCACTGATGCTCTGAGAGTTAGG - Intronic
1081684446 11:45032329-45032351 AAAAAGGGGAACTGAGAGTTGGG + Intergenic
1083277613 11:61606108-61606130 AAACTGGGGTTCAGGGAGATGGG - Intergenic
1083642477 11:64153005-64153027 AAACCGGGGCTCAGGGAGGTTGG + Intronic
1083665504 11:64271928-64271950 GGACTGGGGCTCTGAGAGGTGGG - Intronic
1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG + Intronic
1084314962 11:68340299-68340321 AAACTGAGGCTCTGGGAGATGGG + Intronic
1084385830 11:68842092-68842114 AAACTGAGGCTCGGAGGGTGAGG - Intronic
1084570680 11:69957890-69957912 AAACCGAGGCTCGGAGAGGTTGG - Intergenic
1085195448 11:74669133-74669155 AAACTGAGGCACTGATAGTAAGG - Intergenic
1085266939 11:75242705-75242727 ACCCTGGGGCTCTGAGGATTGGG + Exonic
1085448533 11:76617005-76617027 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1085558154 11:77444438-77444460 AATCTGTGGCTCTGGGGGTTAGG - Intronic
1085619111 11:78023906-78023928 AAACTGGCGCTCTAGGAGGTAGG + Intronic
1085680062 11:78564928-78564950 AGACTGGGGCTGTGTGAATTTGG + Intronic
1085772666 11:79339052-79339074 AAGCTGGGGCTCTGAGTGCCAGG + Intronic
1086651724 11:89299664-89299686 AAACTGGGGCACACAGAGGTAGG - Intergenic
1088166213 11:106940739-106940761 AAGCTGATGCTCTGGGAGTTAGG - Intronic
1089730187 11:120514380-120514402 AAACTGAGGCTCAGAGAGGCTGG + Intronic
1089783134 11:120888338-120888360 AAACTGAGGCTCTGAGAGGTTGG - Intronic
1089978765 11:122755279-122755301 AAACCGAGACTCTGAGAGATGGG - Intronic
1090071863 11:123550865-123550887 AAACTGAGGCTCAGGGAATTCGG - Intronic
1090883488 11:130855419-130855441 AAAGTGGGGCTGTGAGTGCTGGG + Intergenic
1091352492 11:134908210-134908232 AAACTGAGGCTCAGAGAGATTGG - Intergenic
1091749839 12:3015320-3015342 AAACTGAGGCTCTGAGAATTTGG - Intronic
1091832196 12:3557715-3557737 AAACTGAGGCTAGGAGAGGTGGG + Intronic
1092097001 12:5850981-5851003 CAACTGAGGCTCTGAGAGATGGG + Intronic
1093097349 12:14986537-14986559 AAACTGAGGCTCTGTGCTTTAGG - Intergenic
1093779968 12:23123626-23123648 GAACTGGTGCTGTGAGAGTGGGG + Intergenic
1094064280 12:26346804-26346826 AAACTGGGACTCAGAGAATAAGG - Intronic
1094358260 12:29601690-29601712 AAACCTGGGCTCTGAGAGGTTGG - Intronic
1095599315 12:43997121-43997143 AATCTGAGGCCCTGAGAGATTGG + Intronic
1096023247 12:48339487-48339509 AAACTGTGGCTCTCAAAATTTGG - Exonic
1098033068 12:66274016-66274038 AAACTGAGGCTTTCAGAGGTTGG + Intergenic
1098342850 12:69470119-69470141 AAACCGAGGCTCGGAGAATTAGG - Intergenic
1099408172 12:82288813-82288835 ATACTGAGGCTCTGAGCTTTAGG - Intronic
1100362529 12:93891705-93891727 AAACTGAGGCTCAGAGAGGTTGG + Intronic
1102038606 12:109786522-109786544 AAACTGAGGCTGAGAGAGGTGGG + Intronic
1102182003 12:110919906-110919928 CAACTGAGGCTCAGAGAGGTTGG + Intronic
1102426578 12:112848653-112848675 AAAGTGGGGCTCAGAGGGTGGGG + Intronic
1102549620 12:113682350-113682372 AAACTGAGGCTCAGAGAGTTTGG + Intergenic
1102798272 12:115708529-115708551 AAACTGAGGCTCAGAGAGGTAGG + Intergenic
1102956388 12:117061722-117061744 AAACTGAGGCTCCAAGAGTCAGG - Intronic
1103920091 12:124394882-124394904 AAACTGAGGCACAGAGAGGTTGG + Intronic
1104843009 12:131833637-131833659 AAACTAAGGCTCAGAGAGTGTGG - Intronic
1105892147 13:24689509-24689531 GAACTGGGGTTCTGACAGATGGG - Intronic
1105950218 13:25223482-25223504 ACACAAGGGCTCTGGGAGTTAGG - Intergenic
1106267271 13:28121622-28121644 AAACTAGGCTTCTGAGTGTTGGG + Intergenic
1106367798 13:29100154-29100176 AAACTGTGGCTTTAAGTGTTAGG + Intronic
1109339072 13:61031048-61031070 AAACATGGGTTCTGAGAGGTAGG - Intergenic
1113650571 13:112031544-112031566 AAACTGAGGCTCGGGGTGTTAGG + Intergenic
1113893113 13:113746970-113746992 AAACTGAGGCTCTGGGAGGTTGG - Intergenic
1114978786 14:28135686-28135708 AAACTGGGGCAGAGAGAGGTGGG - Intergenic
1116000084 14:39233412-39233434 AAACTGAGGCACAGAGAGATGGG - Intronic
1116748536 14:48851907-48851929 GAACTGAGGCTCGGAGAGTTTGG - Intergenic
1117630605 14:57686895-57686917 ATTCTGAGGTTCTGAGAGTTAGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118915256 14:70097527-70097549 AAACTGAGGCACAGAGAGGTTGG - Intronic
1119223736 14:72928767-72928789 CAACCGGGGCTCTGAGACTGGGG - Intronic
1119641920 14:76321928-76321950 AAACTGAGGCTCTGAGGTTAAGG + Intronic
1119871239 14:78019822-78019844 ATTCAGGGGCTCTGAGAGATTGG + Intergenic
1120295187 14:82631232-82631254 ATTCTGGGGTACTGAGAGTTAGG + Intergenic
1120391096 14:83909650-83909672 AAGCAGGGGCTATGGGAGTTAGG - Intergenic
1120804003 14:88725538-88725560 AAACTGGGGTACTGAGAAATAGG + Intronic
1121542757 14:94741012-94741034 AAACTGTGGCTCTGAGACCTTGG - Intergenic
1122089264 14:99327483-99327505 AAACTGAGGCTCAGAGAGGAAGG + Intergenic
1122089513 14:99328918-99328940 AGGCTGGGGCTCTGAGATTGAGG - Intergenic
1122139156 14:99652128-99652150 AGACTGAGGCTCTGAGAGATGGG + Intronic
1122627575 14:103092070-103092092 AAACTGGGGCTCAGAGATTGAGG + Intergenic
1123759740 15:23423022-23423044 AAGCTAGGGCTCAGAGAGGTTGG + Intergenic
1124274317 15:28313007-28313029 ACACTGAGGCTGTGAGAGGTGGG + Intronic
1125541891 15:40474451-40474473 AAACAGAGGCTCTGAGAGATAGG - Exonic
1125811586 15:42546874-42546896 AAACTGAGGTTCTCAGAGTCGGG - Intronic
1126240271 15:46433866-46433888 TAACTTGGGCCCTGAGAGGTTGG - Intergenic
1126706568 15:51411384-51411406 AGACTGGGGCTCTGACATATGGG + Intergenic
1127661301 15:61102427-61102449 CAGCTGTGGCTCTGACAGTTGGG - Intronic
1127958190 15:63871232-63871254 AAACTGAGGCACAGAGAGGTGGG + Intergenic
1128804698 15:70522117-70522139 AAGCTGGGGCTCAGAGAGGTAGG + Intergenic
1129228137 15:74181645-74181667 AAACTGAGGCCCAGAGAGATTGG + Intronic
1129600209 15:76994383-76994405 AAGCTGAGGCTCAGCGAGTTGGG + Intronic
1129671695 15:77611211-77611233 AGTCTGTGGCTCTGAGAGTCTGG + Intergenic
1129861125 15:78862542-78862564 ATTCTGAGGCTCTGAGGGTTAGG - Intronic
1130416609 15:83700386-83700408 AAACTATAGCTCTGAGAGTTAGG - Intronic
1130844457 15:87731719-87731741 AAACTAGGGCTTAGAGAGTTTGG + Intergenic
1131047889 15:89327517-89327539 GAACTGAGGCTCCGAGAGATGGG - Intronic
1131454574 15:92573061-92573083 CACCTGGGGCTCTGTGACTTGGG - Intergenic
1131536128 15:93239575-93239597 AATCGCAGGCTCTGAGAGTTTGG + Intergenic
1133036332 16:3036210-3036232 AAACTGGGGGGCTGAGGGTCAGG - Intronic
1133832358 16:9334947-9334969 AAACTGTGGCACTGAGATTGTGG - Intergenic
1133854280 16:9535024-9535046 GAACAGGGGCTCACAGAGTTTGG - Intergenic
1134598657 16:15515967-15515989 AAAGTTGGGCTCTGAGTGTGTGG + Intronic
1135115343 16:19718639-19718661 AAACTGAGGCTCGGAGAGGCTGG + Intronic
1136000765 16:27291116-27291138 TAACTGGGGCTCTGCGGGCTGGG - Intergenic
1136608204 16:31350606-31350628 AAACTGAGGCCCTGAGAAGTTGG - Intergenic
1137674846 16:50299127-50299149 AAACTGAGGCTCGGGGGGTTGGG + Intronic
1138227535 16:55310358-55310380 AAACTTGGGCCCTGAAGGTTGGG - Intergenic
1138580634 16:57938660-57938682 AAACTGAGGCTCTGTGTGTGCGG - Intronic
1139663201 16:68436147-68436169 AATCTGGTGCTCTGAGGGTTTGG - Intronic
1139816790 16:69681144-69681166 AAACTTGGGCACAGAGAATTTGG + Intronic
1140300723 16:73754873-73754895 AAACTGGGGTTCTGAGAAATCGG - Intergenic
1140946482 16:79772835-79772857 AAACTGAGGCCCTGAGAAATAGG + Intergenic
1141035619 16:80622972-80622994 AAACTGAGGCTCAGAGAGAAAGG + Intronic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1141284006 16:82654305-82654327 AAGCTGATGCTATGAGAGTTGGG - Intronic
1141710915 16:85698512-85698534 AAACTGAGGCTCAGAGAGGTTGG + Intronic
1141802933 16:86323355-86323377 AAACTGAGACCCAGAGAGTTGGG + Intergenic
1141854378 16:86671039-86671061 AAACTGAGGCTCAGACAGTGAGG - Intergenic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1143277085 17:5719944-5719966 AAACTGAGGCTCAGACAGGTTGG + Intergenic
1143774520 17:9189229-9189251 AAACTGAGGCACAGAGAGATGGG + Intronic
1143788307 17:9273359-9273381 AGACTGGCGCTCAGGGAGTTGGG - Intronic
1145897084 17:28465427-28465449 AAACTGAGGCTCGGAGAAGTTGG - Intronic
1145975738 17:28983171-28983193 AAACTGAGCTTCAGAGAGTTTGG - Intronic
1146259614 17:31412888-31412910 AAACTGAGGCTCAGAGAGGTCGG + Intronic
1148097044 17:45059777-45059799 AAAATGTGGCCCTGAGAGGTTGG - Intronic
1148231813 17:45940721-45940743 AAACTGTGTCCCTGAGACTTTGG - Intronic
1148670601 17:49407269-49407291 AAACAGGGTCCCTGAGAGTGAGG + Intronic
1149361329 17:55898814-55898836 CATGTGGGGCTCTCAGAGTTGGG - Intergenic
1150285212 17:63950314-63950336 AAACTGAGGCACAGAGTGTTAGG + Intronic
1151930646 17:77229669-77229691 AAACTGAGGCTCAGAGGGGTTGG + Intergenic
1152468395 17:80477839-80477861 AAACTGAGGCTCCGAGACTGCGG + Intronic
1152477562 17:80528053-80528075 AAACTGAGGCTCAGAGAGAAAGG + Intergenic
1152962655 18:89052-89074 AAACTGAGGCTCAGAGACCTGGG + Intergenic
1155052759 18:22163279-22163301 AAACTGTGGCACAGAGAGGTTGG + Intergenic
1155985513 18:32226813-32226835 AAATTGAGGCTCAGAGAATTAGG - Intronic
1156503318 18:37573678-37573700 AAATTGAGGCTCTGAGAGCATGG - Intergenic
1156680080 18:39577970-39577992 AAATTGTGGCTCTGTGAATTTGG + Intergenic
1156880392 18:42070601-42070623 AAACTGAGGCCCAGAGACTTTGG - Intronic
1157151682 18:45224485-45224507 AACATGGGGCTCTGAGGGCTGGG + Intronic
1157356248 18:46937196-46937218 AAACTGGGGTTATGCGATTTAGG - Intronic
1158075142 18:53519445-53519467 GTACTGGGGCTCTGAGAAGTTGG - Intronic
1158256176 18:55551425-55551447 AAACTGAGACTCAGAGAGGTAGG + Intronic
1158268005 18:55681409-55681431 AAACTGTGAGTCTGAGAGATTGG + Intergenic
1158298816 18:56029736-56029758 AAACTCGGGCTGAGAGAATTTGG + Intergenic
1158509672 18:58079516-58079538 AAACTGAGCCTCAGAGAGGTTGG + Intronic
1159888470 18:73933070-73933092 AAACTGAGGCTGCGAGAGATGGG + Intergenic
1160614331 18:80112665-80112687 AAAATGAGGCTCTCAGAGATTGG - Intronic
1160789814 19:918227-918249 AAACTGAGGCTCAGAGGGTCAGG + Intronic
1161200258 19:3010667-3010689 AAACTGAGGCTCAGAGAGGTTGG + Intronic
1161517032 19:4702312-4702334 AAACTGAAGCCCAGAGAGTTGGG - Intronic
1161649749 19:5477178-5477200 AGACTGGGCCTCTGTAAGTTAGG - Intergenic
1161845372 19:6709128-6709150 CAACTGGGGCCCTGAGAGGCTGG - Intronic
1161867487 19:6844181-6844203 AAACTGAGGCACTGAGGCTTTGG - Intronic
1162208206 19:9071758-9071780 AAACTGGGGCTCAGAGAACCAGG + Intergenic
1162533812 19:11251519-11251541 AAACTGAGGCCCTTAGAGTTGGG - Intronic
1162833638 19:13302446-13302468 AAAATGGGGCTCAGAGAACTTGG + Intronic
1163356383 19:16814246-16814268 AAACTGAGGCTCTGAGAGGCTGG + Intronic
1163358493 19:16830016-16830038 GAGCTAGGGCTCTGAGAGATTGG - Intronic
1163381057 19:16969087-16969109 AAACAGAGTCTCTGAGAGTTGGG + Intronic
1164155442 19:22593782-22593804 AAACTGGGACATAGAGAGTTTGG + Intergenic
1165315795 19:35054702-35054724 AAGCTGAGGCTCAGAGAGGTGGG - Intronic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1165860847 19:38908569-38908591 AAAATGGAGTTCTGAGAGCTAGG + Intronic
1166548414 19:43648764-43648786 AAACTGAGGCCCAGAGAGGTCGG + Exonic
1166731403 19:45060996-45061018 AAATTGAAGCTCAGAGAGTTCGG - Intronic
1167119439 19:47507825-47507847 AAGCTGGGGCTCAGAGAGGGCGG + Intronic
1167204877 19:48094524-48094546 AAAATGTGGGTGTGAGAGTTAGG - Intronic
1167241017 19:48343065-48343087 AAACTGAGGCTCGGAGAGGGAGG - Intronic
1167604542 19:50474942-50474964 AAACTGAGGCTCAGAGAGCCGGG - Intronic
1167621265 19:50562308-50562330 AAACTGAGGCCCAGAGAGGTGGG - Intronic
925906182 2:8540809-8540831 AAAGGGAGGCTCTGAGACTTGGG + Intergenic
926189211 2:10715235-10715257 AAACTGGGGTATTGAGAGATTGG + Intergenic
926285900 2:11487923-11487945 AAACTGGTGACCTGGGAGTTGGG + Intergenic
926291337 2:11533424-11533446 AAACTGGAGCTCAGGGAGTGAGG + Intergenic
926298498 2:11585618-11585640 AATCTGTGACTCTAAGAGTTTGG + Intronic
926634366 2:15164468-15164490 AAACTGAGGCTCAGAGAGAGAGG + Intergenic
926704133 2:15824795-15824817 AAACTGAGGCTCAGAGAGACTGG - Intergenic
927185559 2:20479698-20479720 AAACTGAGACTCAGAAAGTTTGG + Intergenic
927952762 2:27184362-27184384 ACACGGGGGCTGTGAGAGCTGGG + Intergenic
928201494 2:29250272-29250294 ACACTGAGGCTCAGAGAGTCAGG - Intronic
928305943 2:30170544-30170566 AAACTGAGGCTTAGAGAGGTTGG - Intergenic
929263832 2:39896332-39896354 ATACTGGGGGTCTGTGGGTTGGG + Intergenic
929872937 2:45773729-45773751 AAACAGGGGCTCTGTAACTTGGG - Intronic
929950720 2:46407671-46407693 AAACTGAGGCACAGAGAGGTTGG - Intergenic
930252295 2:49048309-49048331 AACCTGGGGCTCTGAAAAGTTGG + Intronic
931377233 2:61718361-61718383 AAACTCAGGATCTGAGAGTCAGG - Intergenic
931419713 2:62115638-62115660 TAACTGTGGCTATGTGAGTTAGG + Intronic
932401505 2:71483736-71483758 AAACTGAGGCTCTGAGAGATTGG + Intronic
932441338 2:71737592-71737614 AAACTGAGGCTCAGAGAGCATGG - Intergenic
933183814 2:79256773-79256795 AAACTGGGGCTTAGAGAGACTGG - Intronic
933979407 2:87538248-87538270 AAACTGAGGCTCAGAGAGGTTGG - Intergenic
934662620 2:96151211-96151233 AAGCCGTGGCTCTGAGAGCTCGG - Intergenic
935671897 2:105563031-105563053 AAACTGAGGCTATGAGGGATAGG + Intergenic
936314418 2:111412543-111412565 AAACTGAGGCTCAGAGAGGTTGG + Intergenic
937216365 2:120316091-120316113 AAACTGAGGCCCTGTGAGGTGGG + Intergenic
937227495 2:120378152-120378174 AAACTAAGGCTCAGAGAGCTTGG - Intergenic
937289972 2:120776251-120776273 AAACTGAGGGTCAGAGAGGTTGG + Intronic
937299709 2:120831770-120831792 AAACTGAGGCCTGGAGAGTTGGG - Intronic
937390479 2:121481694-121481716 AGACTGGTGCTCTGGGAGTCCGG - Intronic
937862088 2:126719197-126719219 AACCTGTGACTCTGAGAGTGAGG + Intergenic
938076858 2:128344370-128344392 AAAGTGAAGCTCTGAGTGTTGGG - Intergenic
938685075 2:133730197-133730219 CACCTGGGGCTCTGTGAGCTGGG + Intergenic
939918807 2:148082980-148083002 AAACTGGGGCCCAAAGAGGTTGG + Intronic
940078062 2:149765973-149765995 AAACTGGGATACTGAGAGTGAGG - Intergenic
940988882 2:160077617-160077639 AAACTGGGGTTCCCAGAGTCAGG - Intergenic
941061998 2:160857404-160857426 AAACTGGGGTTATGAGTTTTGGG + Intergenic
942486767 2:176448017-176448039 AGTCTGGGGCTCTGAGAGGGAGG + Intergenic
943469969 2:188282572-188282594 AAACTGGGGTTATGAGTTTTGGG - Intergenic
943805985 2:192126722-192126744 AAACTGAGGCTCAGAGAGACAGG + Intronic
944210880 2:197205490-197205512 AAACTGGGGCTTGGGGAGTTTGG + Intronic
945261099 2:207844144-207844166 CTAGTGTGGCTCTGAGAGTTGGG - Intronic
945418743 2:209607825-209607847 AGACTGGGGCTTTCAGAATTAGG - Intronic
945528734 2:210923629-210923651 AAACTGGGTCTTAAAGAGTTAGG + Intergenic
946333206 2:219021982-219022004 AAAATGGGGCTGGGAGAGTGGGG - Intronic
947921522 2:233879360-233879382 AAACTGGGGTTTGGAGAGGTTGG + Intergenic
948087254 2:235261822-235261844 AAGCCAGGACTCTGAGAGTTTGG - Intergenic
948726617 2:239938164-239938186 AAACTGAGGCCCTGACAGATGGG - Intronic
1170901446 20:20467158-20467180 AATATGGGCCCCTGAGAGTTGGG - Intronic
1170939444 20:20836235-20836257 TCACTGGGGCCCAGAGAGTTAGG + Intergenic
1170983725 20:21239173-21239195 AAACTGGTGCTTGGAGAGGTAGG + Intronic
1171492660 20:25532256-25532278 AATCTGGGGCTCTGGGAGGAAGG - Intronic
1172107709 20:32526733-32526755 AAACTGGGACCCAGAGAATTGGG - Intronic
1172162936 20:32880861-32880883 ACTCTGGGGCTGTGGGAGTTAGG + Intronic
1172619754 20:36311184-36311206 AAACTGAGGCTCAGAGTGGTTGG + Intronic
1172677300 20:36682724-36682746 GAACTGAGGCTCAGAAAGTTAGG - Intronic
1173224456 20:41154120-41154142 AAAATGAGGCTCAGAGAGATGGG + Intronic
1173841545 20:46160679-46160701 AAACTGAGGCTCAGAGAGGTGGG - Intergenic
1173847464 20:46197194-46197216 AAATTGAGGCTTGGAGAGTTTGG - Intronic
1174082431 20:47979933-47979955 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
1174304883 20:49608136-49608158 AAGCTGAGGCTCGGAGAGGTGGG - Intergenic
1174502424 20:50995488-50995510 AAACTGGGGCTCTGTTACTAAGG + Intergenic
1174946668 20:54993776-54993798 TAACTTGGTCTCTGAGAGCTGGG + Intergenic
1175161734 20:57012881-57012903 AAACTGAGGCTCAGAGAGGTGGG + Intergenic
1175379147 20:58550773-58550795 AAGCTGGTGCTCACAGAGTTGGG + Intergenic
1175411984 20:58776468-58776490 ATACTGAGGCTCAGAGAGGTGGG - Intergenic
1175420342 20:58828515-58828537 AAACTGAGGCTTAGAGAGGTGGG - Intergenic
1175752553 20:61509241-61509263 ACGGTGGGGCTCTGAGAGCTGGG - Intronic
1178174745 21:30083632-30083654 AAACTGGGGCTTAGAGAGGGAGG - Intergenic
1178753816 21:35328787-35328809 AAACTGGAGCTCAGAGAGATGGG - Intronic
1178839451 21:36127200-36127222 AAACTGAGACACTGAGAGATTGG + Intergenic
1179121429 21:38549812-38549834 AACCTGGGGCGGTGAGAGTGAGG + Intronic
1179346803 21:40565823-40565845 AAACTGGGACTCTGAAGTTTTGG - Intronic
1179418956 21:41220625-41220647 AAACTGTGGCTTTGAAACTTGGG + Intronic
1179528347 21:41999492-41999514 AAACTGAGGCTCAAAGAGGTTGG - Intronic
1179551875 21:42148603-42148625 AAACAGGGGCTCAGAGAGATTGG - Intergenic
1179729240 21:43358468-43358490 ATTCTGGGGCACTGAGGGTTAGG - Intergenic
1179933238 21:44585957-44585979 ACACTGGGGCTCTCAGGGTGGGG + Intronic
1180132390 21:45835068-45835090 AACCTGTGGCTCTGTGAGTGGGG - Intronic
1180595404 22:16969836-16969858 AATCTGGTGCACTGAGAGTGGGG + Intronic
1181671271 22:24426620-24426642 AACCTGGGGCTCTGGGTGGTGGG + Intronic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1181991155 22:26837988-26838010 AAACTGAGGTTCAGAGAGGTTGG + Intergenic
1182102930 22:27670534-27670556 AAACTGAGGCTCAGAGAGGAGGG + Intergenic
1182549250 22:31092153-31092175 AAACTGAGGCTCAGAGAGGGTGG + Intronic
1183057473 22:35315723-35315745 AAACTGTGGCTCTGAGACCTTGG - Intronic
1183084298 22:35477170-35477192 AAACTGAGGCCCAGAGAGTGGGG + Intergenic
1183164811 22:36139663-36139685 AAACTGAGGCTCAGAGAGGCGGG + Intergenic
1183171092 22:36188787-36188809 AAACTGAGGCTCAGAGAGATGGG + Intergenic
1183296174 22:37030805-37030827 AAACTGAGGCTCCGAGAGGTTGG - Intergenic
1183394031 22:37561290-37561312 AAACTGAGGCTTAGAGAGTAGGG + Intronic
1184239623 22:43205310-43205332 ACACTGGGGCTCAGAGAGGGCGG - Intronic
1184526751 22:45028539-45028561 AAACTGAGGCACAGAGAGATTGG + Intergenic
1184650596 22:45917895-45917917 AAACTGAGGCACAGAGAGTAAGG - Intergenic
1185314832 22:50174494-50174516 TCACTGGGGCTCTGAGGGCTGGG + Intronic
950420795 3:12898174-12898196 AAGCTGTGGCTCTGACAGGTGGG + Exonic
950715726 3:14846455-14846477 AAATATGGGTTCTGAGAGTTTGG - Intronic
950743690 3:15069750-15069772 AAACTGAGGCTCAGAGATTGAGG - Intergenic
950875306 3:16265760-16265782 AAACTGAGGTACAGAGAGTTGGG + Intronic
952074371 3:29677924-29677946 AAACTGAGGCTCAGAGTATTTGG - Intronic
952636663 3:35541344-35541366 AAACTGGAGTTTTGAGAGGTAGG + Intergenic
953043799 3:39277852-39277874 AAACTGAGCCTCAGAAAGTTTGG - Intronic
953151517 3:40329425-40329447 AAACTGAGGCTGTGAGAGACTGG - Intergenic
953208795 3:40856047-40856069 AAATTCAGGCTCTGAGAATTAGG + Intergenic
953911163 3:46893706-46893728 AAGCTGTGGCTCTGAGGGGTAGG - Intronic
954160622 3:48719015-48719037 AATGAGGGGCTCTGAGAGCTGGG - Intronic
954906170 3:54064859-54064881 AAACTGAGGTTCAGAGAGGTTGG - Intergenic
955502647 3:59600231-59600253 AAACTGAGGCTCTGGGGGCTAGG + Intergenic
956006843 3:64788752-64788774 AAAATGAGCCTCAGAGAGTTTGG + Intergenic
956309298 3:67861127-67861149 AAGCTGGAGCTCTGAGAGTTAGG - Intergenic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
956784563 3:72631685-72631707 AACATGAGGCTCTGAGAGTCAGG - Intergenic
956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG + Intergenic
958007952 3:87836760-87836782 AAACTAAGGGTCAGAGAGTTTGG + Intergenic
959560774 3:107778258-107778280 AAACAGGGTCTCTGGGAATTAGG - Intronic
960571631 3:119190587-119190609 AAACTTGGGCCCTGGGAGTCAGG - Intronic
960662265 3:120073461-120073483 AAACAGTGGCTGTGAGAGATGGG - Intronic
960946306 3:122969171-122969193 AAACTGAGGCTCAGAGAGGTTGG + Intronic
961357255 3:126346875-126346897 AAACTGAGGCTCAGGGAGCTTGG - Intronic
961448887 3:126993529-126993551 AACTTGGGGCTCTGAGGGGTGGG - Intronic
961626141 3:128264983-128265005 AAACAGGCGCTATGAGAATTAGG - Intronic
962238805 3:133732851-133732873 GAATTGGGGCACTGAGAGCTTGG + Intergenic
962301003 3:134243084-134243106 AAGCATGGGCTCTGAGATTTAGG + Intronic
962422376 3:135239934-135239956 AAACTGAGGCACAGAGAGGTAGG + Intronic
962646026 3:137441146-137441168 AAACTGAGGATCAGAGAGGTTGG + Intergenic
962977201 3:140456109-140456131 TAACTGGGTATCTGAGAGCTGGG + Intronic
965705825 3:171507134-171507156 AAACTGTGGCTCAGAGGCTTTGG + Intergenic
966050564 3:175613023-175613045 CAGCTAGGGCTCTGAGACTTTGG + Intronic
966208987 3:177433449-177433471 AAATGGGGGCTCTGAGAGATGGG + Intergenic
967137583 3:186525488-186525510 AAACGGGGGCTCAGAGAGGCAGG + Intergenic
967244553 3:187472133-187472155 AAACTGGGTCTCTGAGCTGTGGG - Intergenic
967478121 3:189944137-189944159 AAACTGAGGCTCAGAGAAGTTGG - Intergenic
967833379 3:193941337-193941359 AAACTGAGGCTCAGAGAGGTTGG - Intergenic
968495801 4:914686-914708 ATGCTGGGGCTCTGTGTGTTGGG - Intronic
968495825 4:914773-914795 ACACTGGGGCTGTGTGTGTTGGG - Intronic
968530807 4:1090486-1090508 ACACTGGGGCCTTGGGAGTTTGG - Intronic
968616434 4:1579583-1579605 AAACGGGGGCTCAGAGAGGTCGG - Intergenic
968786661 4:2626964-2626986 AAATGGGGGCTCTGTGAGGTTGG + Intronic
969101176 4:4769296-4769318 AAACTGAGGCTTTGGGAGATGGG + Intergenic
969175854 4:5398574-5398596 ACACTGAGGCTCAGAGAGGTGGG - Intronic
969307207 4:6332667-6332689 GAACTCGGGCACTGAGAGGTAGG - Intronic
970445911 4:16123262-16123284 ACACTGAGGCTCAGAGAGGTTGG + Intergenic
970575006 4:17418563-17418585 AAACTGAGGGTCGGAGAGGTTGG + Intergenic
970681042 4:18508404-18508426 AAAGTGAGGCTCTGAGAGTTTGG - Intergenic
970981524 4:22104189-22104211 AAACTGGGGCTCAGTGAAATTGG - Intergenic
971677791 4:29656363-29656385 AGAAAGGGGCTGTGAGAGTTTGG + Intergenic
972591215 4:40489000-40489022 AAACTTGGGCTCTGGGGTTTGGG - Intronic
978164191 4:105587104-105587126 AATCTGGGGCACTGAGAGGCAGG + Intronic
978440697 4:108730351-108730373 AAACTTGGTGTCTGAAAGTTGGG - Intergenic
979913778 4:126404755-126404777 AAACTGGTGCTCTGAATGCTTGG - Intergenic
980973100 4:139585296-139585318 AAATTAGTCCTCTGAGAGTTTGG + Intronic
981130920 4:141157452-141157474 AAACTAGGGCTCTGTCAGTAAGG + Intronic
981455819 4:144952215-144952237 TAACTGAGGCTCTGAGACCTGGG - Intergenic
981594475 4:146403799-146403821 AAACTAGGACTCAAAGAGTTTGG - Intronic
981697342 4:147572596-147572618 AAACTGGGGGTCTGAGTATGTGG - Intergenic
982073217 4:151713886-151713908 AAACTGAGGCTTAGAGAGGTGGG - Intronic
983503634 4:168528596-168528618 AAACTGAGACTCAGAGAGGTAGG + Intronic
984113561 4:175649692-175649714 AAACCGAAGCTCTGAGAGTAGGG + Intronic
985196632 4:187437258-187437280 AAACTGGGGCTCAGAGGAATTGG - Intergenic
986810172 5:11349073-11349095 AAACTGGAGCTTGGAGAGCTCGG - Intronic
986811908 5:11368802-11368824 AAACTGGGGATCAAAGAGTTTGG - Intronic
988821445 5:34890133-34890155 AAACTGAAGCTCAGAAAGTTTGG + Intronic
990337113 5:54785868-54785890 TAAGTGTGGCTGTGAGAGTTGGG + Intergenic
990411382 5:55544352-55544374 AAAGTGTGACTCTGAGGGTTAGG - Intergenic
992503645 5:77365217-77365239 AAACAGAGGCTCTGATAGATTGG + Intronic
992672004 5:79070075-79070097 AAACTGAGGCTCGGCGAGTCAGG + Intronic
993785679 5:92132319-92132341 ACACTGGGGCTTTCAGAGGTCGG - Intergenic
995511004 5:112909204-112909226 AAACTAAGGCTCAGAGAGATTGG - Intronic
999232063 5:150067405-150067427 AAACTGAGGTTCTGAGAGGTTGG - Intronic
999250152 5:150177735-150177757 AAAATGAGGCTCAGAGAGGTGGG + Intronic
999343637 5:150795780-150795802 AACCTGGAACTCAGAGAGTTAGG - Exonic
999684570 5:154090806-154090828 AACCTGGGGCTCAGAAGGTTTGG + Intronic
999706183 5:154274275-154274297 AACCTGGGGCTTTGATAGGTAGG + Intronic
999708548 5:154295725-154295747 AAACTGAGGCTCTGGGAGTATGG - Intronic
999743642 5:154575562-154575584 AAACTGATGCTCAGAGAGTTTGG + Intergenic
1000253290 5:159515002-159515024 AAACTGAGCCTCAGAGAGTTAGG - Intergenic
1000333791 5:160226564-160226586 ACACTGGGGCTCTGTGACTTTGG + Intronic
1001603582 5:172944684-172944706 AAACTGAGGCACTGGGAGCTAGG + Intronic
1001772635 5:174307700-174307722 AAACTGAGGCTCAAAGAGGTGGG + Intergenic
1001874866 5:175191188-175191210 AAACTGAGGCTCAGAGAAGTAGG - Intergenic
1002240349 5:177834802-177834824 GGACTGTGCCTCTGAGAGTTAGG - Intergenic
1003314605 6:5001187-5001209 AAACTGAGGCTTGGAGAGGTTGG - Intronic
1004376788 6:15097436-15097458 AAACTGAGGCTTAGAGAGTTAGG - Intergenic
1004767745 6:18749954-18749976 AAACTTGAGCTGTGAGATTTTGG + Intergenic
1005270460 6:24158266-24158288 AAACTGCAGCTCAGAGAGGTTGG + Intergenic
1005309998 6:24549911-24549933 AAACTGGGGCAGTGAGAATGGGG + Intronic
1006005646 6:30999958-30999980 AAAGTAGGGGTCTGAGAGCTTGG - Intergenic
1006433819 6:34015501-34015523 AAACTGAGGCCCAGAGAGTCAGG - Intergenic
1007276759 6:40679772-40679794 AAACTGGGGCTCTCTGAGGATGG - Intergenic
1007664293 6:43505363-43505385 TAGCTGGGGCACTGAGTGTTAGG - Exonic
1007704525 6:43782763-43782785 AGACTGGGGCTCTGAGGGCAAGG + Intronic
1007707207 6:43798222-43798244 AAACTGGGGCTCCCTGAGTCAGG - Intergenic
1007775340 6:44221848-44221870 AAACTGGGGCCCTGCCAGCTCGG - Intronic
1007937584 6:45747068-45747090 AAACTGGGGTGCAGAGAGTTTGG + Intergenic
1009376334 6:62975142-62975164 ATTCTGAGGTTCTGAGAGTTGGG - Intergenic
1010657118 6:78524627-78524649 ATTCTGGGGCTCTGTGAGATGGG - Intergenic
1011187817 6:84698463-84698485 AAACTGAGGTTCTGATAGTAAGG + Intronic
1011525692 6:88262252-88262274 AAACTGAGGCTCAATGAGTTTGG + Intergenic
1012225856 6:96702712-96702734 AAAAAGGGGCTCTAACAGTTTGG + Intergenic
1012509919 6:99991430-99991452 AAACTGAGGCTCAGACAGGTTGG - Intronic
1013071414 6:106732613-106732635 AACCTGGTGCTCTGAGACTGGGG + Intergenic
1013139789 6:107321566-107321588 AAACTGAGGAGCTGAGAGGTGGG + Intronic
1013349449 6:109292087-109292109 GAACTGGGGCTTTGATAGGTAGG + Intergenic
1013401095 6:109797000-109797022 AAACTGGGTCTCTGAGGGATAGG + Intronic
1013819549 6:114138045-114138067 AAAAGGAGGCTCTGAGAGTTGGG + Intronic
1014480728 6:121933317-121933339 AAACTGGGGTTGGGAGAGGTAGG - Intergenic
1014537309 6:122629730-122629752 AGACTGTGGCTATGAGATTTTGG - Intronic
1015199327 6:130561573-130561595 AATGTGGGGCTATGAGATTTGGG - Intergenic
1015456361 6:133431128-133431150 GAATTGGGGCTCTGTGAGTGAGG + Intronic
1015469531 6:133588393-133588415 AAACTGAAGCTCAGACAGTTAGG + Intergenic
1015713397 6:136165878-136165900 AAACTGAGGTTCTGTGAGTAAGG + Intronic
1016362185 6:143279365-143279387 AACCTGCGGGTCTGAGAGTGAGG + Intronic
1016544197 6:145202237-145202259 AAACGGGGGGTCAGAAAGTTTGG - Intergenic
1016795936 6:148117319-148117341 AAACTGAGGCCCTGAAAGTTCGG - Intergenic
1017581457 6:155869106-155869128 AAACTGAGTCTCTGAGAGTGAGG + Intergenic
1018663365 6:166110139-166110161 AAAATGGGGCTCTAAGCATTTGG + Intergenic
1019279084 7:191400-191422 AAACTGAGGCTCAGAGAGGGCGG + Intergenic
1019346877 7:535456-535478 AAGCTGGGGCGCTGTGGGTTTGG - Intergenic
1019478911 7:1257087-1257109 AAGCCGGGGCTCAGAGAGGTTGG + Intergenic
1019703881 7:2488269-2488291 AAACTGAGGCTCAGAGAGACGGG + Intergenic
1020255965 7:6503362-6503384 AAACTGGGACTCAGAGGCTTGGG + Intronic
1021558018 7:21941421-21941443 AAAATGGGGCACGGAGAGTAGGG + Intronic
1022474070 7:30699129-30699151 AAACTGAGGCTCAGAGTGGTAGG - Intronic
1022633724 7:32111055-32111077 AAACAGGGCTTCTGAGAGTGAGG + Intronic
1023382086 7:39618890-39618912 AGAGTGGGGTTATGAGAGTTTGG - Intergenic
1023830935 7:44038763-44038785 CAAGTGGGGCTCTGAGAGGCCGG - Intergenic
1023875344 7:44283565-44283587 AGACTTGGGCTCTGTTAGTTAGG + Intronic
1024329331 7:48140698-48140720 TAACTGGGACTCTGAGAGCAAGG - Intergenic
1024816903 7:53282097-53282119 TAACTGGGCCTCTTTGAGTTAGG - Intergenic
1025025656 7:55514354-55514376 AAACGGGGGCCCAGAGAGGTTGG + Intronic
1027487174 7:78776045-78776067 AAACTGAGGTACAGAGAGTTTGG - Intronic
1028464499 7:91135200-91135222 AAACTGGGGGACAGAGGGTTGGG + Intronic
1028985397 7:97005299-97005321 CAACTGGGGCTCCGGGATTTGGG + Intergenic
1029741269 7:102493072-102493094 CAAGTGGGGCTCTGAGAGGCCGG - Intronic
1029759259 7:102592241-102592263 CAAGTGGGGCTCTGAGAGGCCGG - Intronic
1029776628 7:102688151-102688173 CAAGTGGGGCTCTGAGAGGCCGG - Intergenic
1030113916 7:106049115-106049137 AAACTGGGAATCTCAGACTTCGG + Intergenic
1030678849 7:112413093-112413115 CAACTGTGGCACTGAGAGATTGG - Intergenic
1031240038 7:119226079-119226101 ACACTGGAGCTCTCAGAGGTTGG + Intergenic
1031463671 7:122082274-122082296 AAAGTGGAGATCTGTGAGTTAGG - Intronic
1031665893 7:124481518-124481540 AAACTAAGGCTATGATAGTTTGG - Intergenic
1033536866 7:142320670-142320692 ATACTGGTCCTCTGAGAGCTGGG - Intergenic
1033669876 7:143481627-143481649 AAACTGAGGCTCAGAGAGCAAGG + Intergenic
1034076776 7:148239695-148239717 AATCTGAGGCTCTGGTAGTTGGG - Intronic
1034265421 7:149778264-149778286 GAGCTGGTGCTGTGAGAGTTTGG - Intergenic
1034265425 7:149778302-149778324 AAACTGAGGCTCGGGCAGTTAGG - Intergenic
1035002236 7:155622279-155622301 CAACTGCAGCTCTGAGACTTTGG - Intronic
1035236279 7:157499576-157499598 ATGCTGGGGCTCGGAGAGGTGGG - Intergenic
1035541281 8:440404-440426 AAAATGGGGCCCAGAGAGATGGG + Intronic
1035870859 8:3134804-3134826 AAAATGAGGCTCAGAGAGGTTGG - Intronic
1036385631 8:8277816-8277838 CAACTGAGGCTCTTAGATTTTGG - Intergenic
1037420605 8:18697960-18697982 AATCTTGTGATCTGAGAGTTAGG - Intronic
1037473267 8:19231747-19231769 AAAGTGGAGCTTTGAGAGTCAGG - Intergenic
1038245056 8:25847648-25847670 AAACTGAGGCTCTGAGATAATGG + Intronic
1040001950 8:42584540-42584562 AAACTGTGGCTAAGAGTGTTTGG - Intergenic
1040637712 8:49294919-49294941 AATCTGTGGCACTGAGAATTAGG + Intergenic
1041205768 8:55496471-55496493 AAACTGAAGCTCTGAGAGGTTGG - Intronic
1041292777 8:56322240-56322262 AAACTGGGTCACTGAGAGTCAGG + Intergenic
1043741989 8:83825630-83825652 AAACTGGGGCTCAGAGAGATTGG + Intergenic
1044206423 8:89496555-89496577 CAGCTGGGGCTCTGGGAGTCTGG + Intergenic
1045326208 8:101119501-101119523 CAGGTGGGGCTCGGAGAGTTAGG - Intergenic
1047472795 8:125195550-125195572 AAAATGAGGCTCTGAGATATGGG - Intronic
1047537019 8:125729289-125729311 AAACTGAGGCCCTGAGAGATAGG - Intergenic
1047806732 8:128368867-128368889 AGACTAAGGCTCTGAGAGATTGG + Intergenic
1047825303 8:128567100-128567122 AAACTGAGGCTCAGAAAGTTTGG - Intergenic
1047862127 8:128978781-128978803 TAAGTGGTGCTATGAGAGTTTGG + Intergenic
1048254591 8:132896205-132896227 AAACTGAAGCTCAGAGAGGTTGG + Intronic
1048330084 8:133465299-133465321 ACACTGAGGCTCTGAGAGGCAGG + Intronic
1048413474 8:134199979-134200001 AAACTGAGGCTCAGAAGGTTTGG + Intergenic
1048566913 8:135610317-135610339 AAACTGAGGCTCAGAGAAGTAGG + Intronic
1049236488 8:141514811-141514833 CACCTGGGGCTCTGAGAATGTGG + Intronic
1050279668 9:4037067-4037089 AAACTGGTGCTCAGAGAGTGGGG - Intronic
1050615942 9:7401935-7401957 AAAAGGGGGCTCTGGGAGTGAGG - Intergenic
1051866642 9:21690969-21690991 AAACTGAGGCTCAGAGGGATTGG - Intergenic
1052475304 9:28951703-28951725 AAGCTGGGGCACTGGGAGCTTGG - Intergenic
1055068707 9:72145399-72145421 AAACTGGGGTTCAGGGAGGTTGG - Intronic
1056475754 9:86949381-86949403 AAACTAGGGATCTGAGTTTTAGG - Intergenic
1057334722 9:94146897-94146919 AAACTGAGGCACAGAGAGGTAGG - Intergenic
1057725465 9:97565028-97565050 AAAGTGACGCTCTGAGAGATTGG + Intronic
1057753300 9:97809656-97809678 AAACTGAGGCTCAGAGAGTAAGG - Intergenic
1058372667 9:104287942-104287964 AAACTGAGGCTCAGAGATATTGG - Intergenic
1058527161 9:105870984-105871006 AAATAGAGGCTCTGAGAGTTTGG + Intergenic
1058767129 9:108192478-108192500 AAACTGAGGCTCTGAGGGTGGGG - Intergenic
1059374116 9:113869009-113869031 AAACTGGGGCTCAGAGACAGTGG + Intergenic
1059614044 9:115929732-115929754 AAAAAGAGGCTCTGAGAGGTCGG + Intergenic
1059699657 9:116762953-116762975 AAACTGAGGCTCAGAGAAATTGG + Intronic
1060641900 9:125245932-125245954 AAACTGTGGCTCTGAGAAATTGG - Intergenic
1060740433 9:126094308-126094330 AAACTGAGGCTCAGAGTGGTTGG - Intergenic
1061217821 9:129231885-129231907 AAACTGAGGCTCACAGAGGTGGG + Intergenic
1062196895 9:135279407-135279429 AAGCTGAGGCTCAGAGAGGTGGG + Intergenic
1062272293 9:135715014-135715036 AAACTGGGGTGCTGGGGGTTGGG - Intronic
1062735485 9:138135064-138135086 AAACTGAGGCTCAGAGACCTGGG - Intergenic
1203653951 Un_KI270752v1:5675-5697 AAACTGGCCCTATGAGAGTTTGG + Intergenic
1185769521 X:2754965-2754987 AAACTGAGGCACTGAGGATTTGG + Intronic
1186980257 X:14950981-14951003 AAACTGAGGCTCACAGAGGTCGG + Intergenic
1187061178 X:15788859-15788881 AAACTGGGGCAATGAGAGTAGGG - Intergenic
1187233112 X:17441281-17441303 AGACTGAGGCTCAGAGAGGTTGG + Intronic
1187267463 X:17748043-17748065 AACCTGGAACTCTGAGAGTGGGG - Intronic
1187889759 X:23923317-23923339 AAACTGGGTCTTGGAGAGATTGG + Intronic
1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG + Intergenic
1189428889 X:40929975-40929997 CAACTGGGGTTATGAGAATTGGG - Intergenic
1190013276 X:46803953-46803975 AAACTGGGTGTCTGGGAGATGGG - Intergenic
1191740857 X:64434205-64434227 CAACTGAGGTCCTGAGAGTTAGG - Intergenic
1191912525 X:66166053-66166075 AAACTGAGGCTCAGGAAGTTAGG + Intronic
1194474667 X:94343915-94343937 AAACTATAGCTCAGAGAGTTTGG + Intergenic
1196025282 X:111035353-111035375 AAACTGAGGCTTAGAGATTTGGG - Intronic
1196371637 X:114985715-114985737 AAAGTGTGGGTATGAGAGTTTGG - Intergenic
1197164038 X:123356728-123356750 GAACTGGGGATCAGAAAGTTTGG + Intronic
1197176149 X:123487620-123487642 AAACAGAGGCACTGAGAGGTTGG + Intronic
1197627886 X:128823572-128823594 GAACTGAGACTCTGAGAGGTTGG + Intergenic
1197761831 X:130033466-130033488 AAAGTGGGGCTCAGAGAGGGAGG + Intronic
1199256079 X:145720275-145720297 AAACTGGAGTTTTGACAGTTAGG + Intergenic
1200397705 X:156000917-156000939 AAACTGAGGCTCAGAGACCTGGG - Intronic
1201300986 Y:12504664-12504686 AAACTGAGGCACTGAGGATTTGG - Intergenic