ID: 1083667599

View in Genome Browser
Species Human (GRCh38)
Location 11:64284418-64284440
Sequence CTGCCTTCCAGGGCCACCGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083667599_1083667613 30 Left 1083667599 11:64284418-64284440 CCAACGGTGGCCCTGGAAGGCAG 0: 1
1: 0
2: 1
3: 24
4: 213
Right 1083667613 11:64284471-64284493 GTAGCGCCCCCAGGCCCGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 141
1083667599_1083667609 21 Left 1083667599 11:64284418-64284440 CCAACGGTGGCCCTGGAAGGCAG 0: 1
1: 0
2: 1
3: 24
4: 213
Right 1083667609 11:64284462-64284484 TCTCCCACCGTAGCGCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 91
1083667599_1083667604 -7 Left 1083667599 11:64284418-64284440 CCAACGGTGGCCCTGGAAGGCAG 0: 1
1: 0
2: 1
3: 24
4: 213
Right 1083667604 11:64284434-64284456 AAGGCAGAGGCAGGTACCCCTGG 0: 1
1: 0
2: 2
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083667599 Original CRISPR CTGCCTTCCAGGGCCACCGT TGG (reversed) Exonic