ID: 1083667863

View in Genome Browser
Species Human (GRCh38)
Location 11:64285328-64285350
Sequence AGGGAGGACCGTAGGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083667851_1083667863 9 Left 1083667851 11:64285296-64285318 CCGGGCGCGGGAGGAGGGCCGGG 0: 1
1: 0
2: 5
3: 66
4: 536
Right 1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG 0: 1
1: 0
2: 2
3: 8
4: 111
1083667849_1083667863 10 Left 1083667849 11:64285295-64285317 CCCGGGCGCGGGAGGAGGGCCGG 0: 1
1: 0
2: 7
3: 64
4: 450
Right 1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG 0: 1
1: 0
2: 2
3: 8
4: 111
1083667858_1083667863 -9 Left 1083667858 11:64285314-64285336 CCGGGGACCCGGTGAGGGAGGAC 0: 1
1: 0
2: 1
3: 13
4: 220
Right 1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG 0: 1
1: 0
2: 2
3: 8
4: 111
1083667840_1083667863 28 Left 1083667840 11:64285277-64285299 CCCTGGCTGGGATGGCTGCCCGG 0: 1
1: 0
2: 1
3: 25
4: 266
Right 1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG 0: 1
1: 0
2: 2
3: 8
4: 111
1083667842_1083667863 27 Left 1083667842 11:64285278-64285300 CCTGGCTGGGATGGCTGCCCGGG 0: 1
1: 0
2: 1
3: 112
4: 1923
Right 1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG 0: 1
1: 0
2: 2
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083667863 Original CRISPR AGGGAGGACCGTAGGGCCCG TGG Intronic
900229984 1:1551800-1551822 AGGGAGGGTGGTGGGGCCCGAGG + Intronic
900290656 1:1922247-1922269 AGGGTGGACAGGAGGGCCCGAGG + Exonic
900973094 1:6002217-6002239 AGGGAGGACCAGAGGGCTCCTGG + Intronic
901018023 1:6242652-6242674 AGCCCGGACCGCAGGGCCCGCGG - Intergenic
903665120 1:25001412-25001434 AGGGAGAACCCGAGGGCCCCTGG - Intergenic
904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG + Intronic
907159412 1:52359790-52359812 CGGGATGACAGCAGGGCCCGCGG + Exonic
908401408 1:63775044-63775066 CGGGAGGGCCGGAGGGCCGGGGG - Intronic
918374042 1:183890808-183890830 TGGGAGGACGGTAGGGTCCCAGG + Intronic
921189833 1:212699632-212699654 AGGGAGGGCCGTGGGGTGCGGGG - Intronic
1069896252 10:71681954-71681976 AGGGAGGCCTGGAGGGCCCAAGG + Intronic
1070935695 10:80293104-80293126 AGGGAGGACCCTAGGTGCAGAGG + Intergenic
1071605055 10:86980187-86980209 AGGGAGGAACGCAGGGACTGGGG + Intronic
1071847344 10:89534734-89534756 AGGGAGGATCGTTGGAGCCGGGG + Intronic
1073424854 10:103450182-103450204 AGGAAGGACCATAGGGCCCCAGG + Intronic
1075346209 10:121683673-121683695 AGGGAGGAGGGCAGGGACCGGGG - Intergenic
1076644657 10:131944654-131944676 AGGGAGGACGGCAGGGACCCTGG - Intronic
1076679201 10:132163032-132163054 GGGGAGGTCCGTGGGGCCCCTGG + Intronic
1076871395 10:133196718-133196740 AGGGAGGACAGGAGTGGCCGGGG + Intronic
1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG + Intronic
1091802655 12:3334268-3334290 AGGCAGGAGCGCAGGGTCCGAGG + Intergenic
1092250332 12:6891472-6891494 AGGGCGGAAACTAGGGCCCGAGG + Intronic
1096034781 12:48457190-48457212 AGAGGTGACCGTAGGGCCCCAGG + Intergenic
1102782393 12:115576394-115576416 AGGGAGGAGCCTGGGGCCCCTGG - Intergenic
1103507596 12:121452496-121452518 AGGGAGGACCGCCGGCCCCCGGG + Intronic
1109994636 13:70107761-70107783 GGGGAGGACAGCGGGGCCCGGGG + Exonic
1113312122 13:109141246-109141268 TGGGAGGGCTGTAGGGCGCGGGG - Exonic
1115852344 14:37598388-37598410 AGTGAGGACTGTAGGGTGCGCGG + Intronic
1118601282 14:67472827-67472849 AGGGAGCAGCGCAGGGCCCTGGG + Exonic
1122969979 14:105148547-105148569 GGGGAGGAGCGTCGGGCCGGGGG + Intronic
1124723422 15:32133385-32133407 AGGCAGGAGGGTGGGGCCCGTGG + Intronic
1131175068 15:90204179-90204201 AGGGAGGGCACTAGGGCCCTGGG - Intronic
1133223785 16:4330539-4330561 AGGGAGGGCGGTGGGGCCCCTGG + Intronic
1137655214 16:50153389-50153411 AGGGAGGGGGGGAGGGCCCGCGG + Intronic
1140215031 16:73000244-73000266 AGGGAGGGACGAAGGGCACGCGG + Intronic
1140683029 16:77404016-77404038 AGGGAGGACGGTAGGGAGGGAGG - Intronic
1141530108 16:84640509-84640531 AAGGAGGACTGCAGGGCCCTGGG - Intergenic
1143382181 17:6503378-6503400 AGGCAGTACCGGAGGGCCTGGGG - Intronic
1144772436 17:17767177-17767199 AGGGAGGACCCCGGGGCCTGAGG + Intronic
1146836768 17:36117316-36117338 AGGGAGGACTGTAGGTGCAGGGG - Intergenic
1147568361 17:41551627-41551649 AGGGAGAACAGTAGGACCCCTGG + Intergenic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1154293015 18:13127145-13127167 AGGGAGGACGGCAGTGGCCGGGG - Intergenic
1156263991 18:35469462-35469484 AGGGAGGAACTTAGAGGCCGGGG - Intronic
1156498238 18:37540233-37540255 CGGGAGGACCCTAGGGCCACAGG - Intronic
1159236464 18:65680250-65680272 AGGGAGGACCGTCTGGGCCTAGG + Intergenic
1160835662 19:1123400-1123422 AGGGAGGGCCGGAGAGCCCGGGG - Intronic
1161124121 19:2546409-2546431 AGGCAGGGCCGTGGGGCCCAGGG + Intronic
1161511915 19:4676702-4676724 AGGGAGGAGCCTAGGACACGGGG - Intronic
1161567800 19:5013109-5013131 AGGGAGGGCAGAAGGACCCGTGG + Intronic
1161659336 19:5536456-5536478 AGGAAGGACCGGAGGGCACAAGG + Intergenic
1166081184 19:40444740-40444762 AGGGAGGACGCTGGGGCGCGGGG + Intergenic
1166231419 19:41427442-41427464 AGGGAGGGCCCCAGGGGCCGGGG + Exonic
1168134282 19:54339722-54339744 AGGGAGGAACCTAGGGCTCCAGG + Intergenic
926301934 2:11611043-11611065 AGGGAGGGGCGGAGGGCCTGGGG + Intronic
928335492 2:30394517-30394539 AGGGAGGAGCGTAGGACACCCGG + Intergenic
928362766 2:30678990-30679012 AGTGAGGACAGTAGGGTCAGCGG + Intergenic
929602065 2:43210639-43210661 AGGCAGGACCGCAGGGCCTGTGG + Intergenic
929822220 2:45282748-45282770 AGGGAGGCCCATAGGGGCCCAGG + Intergenic
934524594 2:95043784-95043806 AGGGAGGACTGCAGAGCCCAGGG - Intronic
934945478 2:98538101-98538123 AAGGAGGACCGGAGTGTCCGTGG - Intronic
935118752 2:100161255-100161277 AGGTAGGTCCGGAGGGCCAGAGG + Intergenic
937221548 2:120345456-120345478 CGGGAGGACTGCAGGGCCCGCGG + Intergenic
947029993 2:225782824-225782846 AGGGAGGACGGTAGGAAGCGGGG - Intergenic
948846447 2:240685065-240685087 AGGGAGGACCAGAGGACTCGGGG - Intergenic
948847415 2:240689668-240689690 AGGGAGGACCAGAGGACTCGGGG + Intergenic
1169331937 20:4723009-4723031 AGGGAAGACAGGAGGGCCTGGGG - Intronic
1173366655 20:42391952-42391974 AGGGAGGAAAATAGAGCCCGTGG - Intronic
1174095711 20:48088003-48088025 AGGGGGGACCTTGTGGCCCGAGG + Intergenic
1174188169 20:48721751-48721773 AGGGAGGCCCGCTGGGGCCGTGG + Intronic
1176020769 20:62961405-62961427 AGGGAGGACTGAGGGGCACGGGG - Intronic
1176137450 20:63530433-63530455 TGTGGGGACCGGAGGGCCCGGGG + Intronic
1176144682 20:63560279-63560301 GGGGAGGACCGTAGAGCCCCAGG - Exonic
1176372797 21:6072616-6072638 AGGGAGGACCACAGGCCCCAGGG - Intergenic
1176427433 21:6557530-6557552 AGGGAGGGCTCTAGGGCCCTAGG - Intergenic
1179480444 21:41673351-41673373 CGGGAGGACAGCAGGGCCGGCGG + Intergenic
1179702924 21:43165847-43165869 AGGGAGGGCTCTAGGGCCCTAGG - Intergenic
1179750680 21:43465627-43465649 AGGGAGGACCACAGGCCCCAGGG + Intergenic
1182085137 22:27556144-27556166 AGGAAGGACTGAAGGGCCCGGGG + Intergenic
1182797053 22:32998560-32998582 AGGGAGGACCGCAGTGACCTGGG + Intronic
1184661731 22:45968597-45968619 AGGGAGGACAGGAGGTCCTGGGG - Intronic
1184773152 22:46609756-46609778 GGGGAGGGCCGTGGGGCCCCAGG + Intronic
1184890428 22:47375767-47375789 GGGGAGGACTGAAGTGCCCGAGG + Intergenic
950289808 3:11774551-11774573 AGGGAGAGCAGTAGGGCCCTGGG - Intergenic
953493694 3:43369391-43369413 AGGGAGGACTGTAGGGTCCCTGG - Intronic
968612086 4:1561863-1561885 AGGGAGGCCGGTGGGGCCGGCGG - Intergenic
969075607 4:4575454-4575476 TGGGAGGAGCGTGCGGCCCGCGG + Intergenic
969926179 4:10587805-10587827 AGGGGAGACAGTAGGGACCGGGG - Intronic
985485642 5:146704-146726 AGGGAGGGCCGCAGGGTCAGGGG - Intronic
985485653 5:146733-146755 AGGGAGGACTGTAGGGCCAGGGG - Intronic
985802405 5:2013359-2013381 ATGGAGGACCCTGGGGCCTGGGG + Intergenic
988443615 5:31259880-31259902 AGGAAGGACAGTGGGGACCGTGG + Intronic
988558588 5:32260163-32260185 AGGGAGGTCAGTATGGCCAGAGG + Intronic
990210940 5:53480855-53480877 ATGGAGGACCGCAGTGCCCAGGG + Exonic
993641308 5:90409555-90409577 AGGGAGGACGTTTGGGGCCGAGG - Intronic
997291430 5:132738518-132738540 AGGGAGGATTGTAGGGCTTGTGG - Intergenic
1002004071 5:176217426-176217448 ACTGAGGACCGAAGGGCCCCTGG + Intergenic
1002222303 5:177693214-177693236 ACTGAGGACCGAAGGGCCCCTGG - Intergenic
1006910435 6:37560023-37560045 AGGGGGGACCTCAGGGCCCTTGG - Intergenic
1012932854 6:105334823-105334845 AGGGAGGATCTTAGGGGCCCAGG - Intronic
1015525861 6:134175151-134175173 GGGGAGGGCCGGAGAGCCCGGGG + Intronic
1023009685 7:35915340-35915362 AGGAAGGACAGTAGGGACCAGGG + Intergenic
1027267882 7:76504071-76504093 AAGGTGGATCGTAGGGCCTGGGG + Intronic
1027319693 7:77003933-77003955 AAGGTGGATCGTAGGGCCTGGGG + Intergenic
1034278995 7:149838634-149838656 AGGTAGGACTGGAAGGCCCGGGG + Exonic
1034971501 7:155422544-155422566 AGGGAGCACCGTACTGCCCTTGG + Intergenic
1039472564 8:37822322-37822344 AGGGAGGTCTGTGGGGCCAGAGG + Intronic
1041271568 8:56113951-56113973 AGGTAGGGGCGTAGGGCCAGGGG + Exonic
1041381607 8:57258872-57258894 AGGGAGGACCGCAGGGCCAGAGG + Intergenic
1043874006 8:85464355-85464377 CCGGAGGCGCGTAGGGCCCGAGG + Intronic
1048285650 8:133139385-133139407 AGGGCTGACCGTGGGGCCTGGGG - Intergenic
1050090944 9:2016255-2016277 AGGGACGTCCGCAGCGCCCGGGG - Intronic
1053001458 9:34579135-34579157 AGGGAGGAGGGTATGGCCCTTGG - Intronic
1061194866 9:129102228-129102250 AGGGAGGCCAGGAGGGGCCGTGG - Intronic
1061941596 9:133887016-133887038 AGGGAGAGCAGGAGGGCCCGGGG - Intronic
1062609912 9:137369084-137369106 GGGGAGGGGCGCAGGGCCCGGGG + Intronic
1062623805 9:137434103-137434125 AGGCAGCACCGTGGTGCCCGGGG + Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1188005070 X:25011401-25011423 GGGGAGGACCGAAGTGCACGAGG - Intronic
1189331271 X:40146278-40146300 AGGGAGGACCTCAGGGCCGTGGG - Intronic
1200060787 X:153482846-153482868 AGGGAGGACGGCAGGCCGCGTGG - Intronic
1200212053 X:154351090-154351112 AGGGAGGACGGAAAGGCCCCAGG + Intronic