ID: 1083667882

View in Genome Browser
Species Human (GRCh38)
Location 11:64285383-64285405
Sequence GAGCAGGGCCGCGGGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083667875_1083667882 -1 Left 1083667875 11:64285361-64285383 CCTGGCAGGCGGCCGGCCAGGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1083667882 11:64285383-64285405 GAGCAGGGCCGCGGGCGCGCCGG 0: 1
1: 1
2: 2
3: 45
4: 383
1083667870_1083667882 15 Left 1083667870 11:64285345-64285367 CCGTGGGGGCTTCACGCCTGGCA 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1083667882 11:64285383-64285405 GAGCAGGGCCGCGGGCGCGCCGG 0: 1
1: 1
2: 2
3: 45
4: 383
1083667869_1083667882 16 Left 1083667869 11:64285344-64285366 CCCGTGGGGGCTTCACGCCTGGC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1083667882 11:64285383-64285405 GAGCAGGGCCGCGGGCGCGCCGG 0: 1
1: 1
2: 2
3: 45
4: 383
1083667867_1083667882 24 Left 1083667867 11:64285336-64285358 CCGTAGGGCCCGTGGGGGCTTCA 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1083667882 11:64285383-64285405 GAGCAGGGCCGCGGGCGCGCCGG 0: 1
1: 1
2: 2
3: 45
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083667882 Original CRISPR GAGCAGGGCCGCGGGCGCGC CGG Intronic