ID: 1083669510

View in Genome Browser
Species Human (GRCh38)
Location 11:64292192-64292214
Sequence GCGCTTGGCGGCGCGTGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083669501_1083669510 15 Left 1083669501 11:64292154-64292176 CCTCGGGATGGAGCGTGGGCGCG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1083669510 11:64292192-64292214 GCGCTTGGCGGCGCGTGCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083669510 Original CRISPR GCGCTTGGCGGCGCGTGCCG GGG Intronic
900102294 1:967024-967046 GAGCTGGGCGGGGCGGGCCGCGG + Intronic
900349640 1:2228427-2228449 GGCGTTGGCGGCGCGCGCCGGGG + Intergenic
900598054 1:3491333-3491355 GCGCTGGGTGCCGGGTGCCGGGG - Intronic
900987906 1:6083678-6083700 GAGCTGGGCGCTGCGTGCCGGGG + Intronic
902350116 1:15847980-15848002 GCGCCGGGAGGCGGGTGCCGGGG - Exonic
907351440 1:53834965-53834987 GGGCGTGGTGGCGCGTGCTGAGG + Intronic
910936458 1:92486824-92486846 GGCCCTGGCGGCGCGTCCCGCGG + Intronic
911208659 1:95117676-95117698 GCGCTTGGCGGCTGGCGCGGGGG - Intronic
914376921 1:147080120-147080142 GCGCTTGGAGGCGGGAGTCGGGG - Intergenic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
914869168 1:151458966-151458988 GCGAGTGGCGGCGCGGCCCGCGG - Intronic
919830984 1:201539868-201539890 GCGCTTCCCGGCGCATCCCGGGG - Intergenic
920029156 1:203026390-203026412 GCGCTTGGGGGCGGGAGGCGTGG + Intergenic
920698926 1:208203223-208203245 GAGCTTGGCGGCGGGAGCCCGGG + Intronic
923299665 1:232629909-232629931 GCGCCGGGCGGCGCGTACCCGGG + Intergenic
1062889693 10:1048954-1048976 GCGATTGGCTGCGCGGCCCGGGG - Exonic
1063393606 10:5666363-5666385 GCGTTTGGCGGGGTGGGCCGCGG - Intronic
1064011864 10:11742313-11742335 GGGCGGGGCGGGGCGTGCCGGGG + Intergenic
1064011884 10:11742353-11742375 GGGCGGGGCGGGGCGTGCCGGGG + Exonic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067084157 10:43229411-43229433 GCCCTTCGCGGCGCGGCCCGCGG - Intronic
1070732204 10:78838276-78838298 GCTCTTGGTGGGGCATGCCGTGG + Intergenic
1071813483 10:89208063-89208085 ACCCTCGGCGGCGCGTCCCGGGG + Intergenic
1073432084 10:103493615-103493637 GCTCTCGGCGGCGCGGGTCGGGG - Intergenic
1074843329 10:117375638-117375660 GTGGGTGGCGGCGCGCGCCGCGG - Intergenic
1075768926 10:124917198-124917220 GCGCTTGGCGGCGGCGGCGGCGG - Intergenic
1077916002 11:6611982-6612004 ACCCTTGGCGGCGCGGGCCGGGG - Exonic
1080779724 11:35419215-35419237 GCGCTTGGCGGGGAGCTCCGGGG + Exonic
1083669510 11:64292192-64292214 GCGCTTGGCGGCGCGTGCCGGGG + Intronic
1083758402 11:64803201-64803223 GCGCGGGGCGGCGCGGGGCGGGG + Exonic
1084935506 11:72584526-72584548 GCGCGTGGCGGCCCGGGCGGAGG - Intronic
1088495824 11:110430324-110430346 GCGATCGCCGGCGCGGGCCGGGG + Intronic
1089564610 11:119364155-119364177 GCTGTTGGCGGCGCACGCCGGGG - Intronic
1097896161 12:64825879-64825901 GCGCTGGGGGGCGGGGGCCGGGG - Intronic
1102256453 12:111418302-111418324 GCGCGCAGCGGCGCGTGCTGCGG - Exonic
1102289282 12:111685800-111685822 GCGCTGGCCGGCGCGGGCCCCGG + Exonic
1112505024 13:99970386-99970408 GGGCTTGGCGCCGCCGGCCGGGG + Exonic
1113494026 13:110713938-110713960 GCGCCTGAGGGCGCGGGCCGCGG - Intronic
1122779671 14:104138434-104138456 GTGCTGGGCGGCGCGTGGGGGGG - Intergenic
1129948242 15:79560596-79560618 GCGCGGGGAGGCGCGGGCCGGGG + Intergenic
1132683833 16:1154109-1154131 GCGCGCGGGGGCGCATGCCGAGG - Intronic
1137707934 16:50548340-50548362 GCGCGGGGAGGCGCGGGCCGCGG + Exonic
1139215479 16:65122055-65122077 GCGCTCGGCGGCTCATTCCGCGG - Exonic
1140221505 16:73047803-73047825 GCGCATGGCGGCGCGGCCCCCGG - Exonic
1141132394 16:81445061-81445083 GCGGGGGGCGGCGCGTGCGGCGG - Intergenic
1142664739 17:1456172-1456194 CCGCTGGGCGGCGGGCGCCGGGG - Exonic
1144682781 17:17206367-17206389 GCCGCTGGCGGCGCGTGACGGGG - Intronic
1148167039 17:45490801-45490823 GCGATTGGCACCGCGGGCCGGGG - Intergenic
1150398217 17:64837206-64837228 GCGATTGGCACCGCGGGCCGGGG - Intergenic
1151660677 17:75516524-75516546 GGGCGTGGCGGCGCGCGCAGCGG + Exonic
1152718552 17:81911408-81911430 GCGCCTGGCGGGGCGGGCGGCGG - Intronic
1152925319 17:83084986-83085008 GCGCTGTGCGGCGGGTGCCGTGG + Exonic
1153805466 18:8705866-8705888 GCGCGGGGCGGCGGGAGCCGGGG - Intronic
1154241607 18:12658127-12658149 GCGCTGGACGGCGCGAGGCGGGG - Exonic
1154501474 18:14999868-14999890 GCGCTTGGACGCGGGTCCCGGGG + Intergenic
1160790206 19:919576-919598 GCGCCAGGCGGGGCGTGCGGCGG - Exonic
1160966479 19:1749036-1749058 GGGCTTGGCGGCGAGGGGCGCGG - Intergenic
1162567615 19:11453033-11453055 GGGCCTGGCGGGGAGTGCCGGGG + Exonic
1162975855 19:14206690-14206712 GCGGCTGGAGGCGGGTGCCGCGG + Intergenic
1167110357 19:47457120-47457142 GCGCAGGGCGGCGCCGGCCGAGG - Exonic
931719332 2:65056101-65056123 GCGCTTAGGGGTGGGTGCCGGGG - Intergenic
932036655 2:68252636-68252658 CCGCTGGGCGGCGAGTGCCGCGG + Intronic
938500655 2:131830050-131830072 GCGCTTGGAAGCGGGTCCCGGGG + Intergenic
940774940 2:157875872-157875894 GCGCGGGGCGGCGCGGGGCGGGG + Intergenic
941089652 2:161160268-161160290 GCGCTAGGCGGGGCGGGCAGGGG + Intronic
948801732 2:240436247-240436269 GGGCTTGGAGGCGAGGGCCGTGG - Intronic
1171245435 20:23606566-23606588 GCACTTGGCAGCGCGTCCCTGGG - Intergenic
1174467763 20:50730998-50731020 GCGCTAAGCGGCGCGAGCCCCGG + Intergenic
1175161911 20:57014601-57014623 GGGCTTGGTGGCACGTGCCGTGG - Intergenic
1179243752 21:39612823-39612845 GCGCAGGGCGGCGCGGGCTGGGG - Intronic
1180215970 21:46324071-46324093 CTGATTGGCGGCGCGTGTCGGGG + Intergenic
1180959270 22:19755342-19755364 GCGGGTGGGGCCGCGTGCCGGGG - Intergenic
1181478067 22:23180757-23180779 GCGCGGGGCGGGGCGCGCCGGGG - Exonic
1183093761 22:35540502-35540524 GCGCTGGGCGGCGGGAGGCGCGG + Intergenic
954838898 3:53494530-53494552 GCGCGGCGCGGCGCGGGCCGTGG + Intergenic
955246633 3:57230858-57230880 GAGCTTGGTGGCGTGTGCCCAGG - Intronic
956978970 3:74614599-74614621 GCGCTTGGCGGCGGCGGCGGTGG - Intergenic
960960508 3:123067383-123067405 GCGCTTGGCGGCGAGGGCACCGG - Intronic
961377365 3:126475784-126475806 GGGCTCGGCGGAGCGGGCCGGGG + Exonic
968965120 4:3765838-3765860 GCGCGGGGCGGGGCGGGCCGCGG - Intergenic
973619400 4:52712291-52712313 GGGATTGGCTGTGCGTGCCGCGG + Intergenic
986858951 5:11904243-11904265 GCGCTCGGCGCCGGGCGCCGCGG - Intergenic
990165373 5:52988928-52988950 GCTCCTGGCAGCGGGTGCCGAGG - Intergenic
996698385 5:126423474-126423496 GCGCTGGGCGGAGGGTGCAGGGG + Intronic
998142730 5:139709335-139709357 GCGTTTGGCGCGGCGTGGCGGGG + Intergenic
1002186201 5:177455954-177455976 GGGCAGGGCGGCGCGGGCCGAGG - Exonic
1002524324 5:179806913-179806935 GGGCTGGGCGGCGAGAGCCGCGG + Intronic
1004044585 6:12012120-12012142 GGGCTGGGGGGCGCGCGCCGCGG - Intronic
1007359580 6:41345516-41345538 GCCCTTGGTGGCGGGTGCTGGGG - Intronic
1013514768 6:110875492-110875514 GCGCTGGGCGGCGGGCGGCGCGG + Intronic
1018330986 6:162727509-162727531 GAGCCCGGCGGCGCGGGCCGGGG + Intronic
1018400059 6:163413744-163413766 GCTTTTCGAGGCGCGTGCCGCGG - Intergenic
1019536195 7:1530988-1531010 CCGCCTGGGGGCGCGGGCCGAGG + Intronic
1020034883 7:4958907-4958929 GCGCGCGGCGGCGGGGGCCGCGG - Intronic
1020034997 7:4959256-4959278 GCGATTGGCAGCGCGAGCCCGGG - Intergenic
1023243707 7:38178317-38178339 GGGCTTGGCGGGGCGTGACCGGG - Exonic
1023881907 7:44325528-44325550 CCGCCTGGCGCCGCGAGCCGAGG - Intronic
1025004801 7:55345195-55345217 TCTCTTGGCGGCTCGGGCCGTGG - Intergenic
1031011006 7:116525506-116525528 GCGCCTGGCGGAGAGTCCCGGGG - Intronic
1033361291 7:140640591-140640613 GCGGGCGGCGGCGGGTGCCGGGG + Exonic
1033657120 7:143381711-143381733 GCGCTGGGCCCCGGGTGCCGGGG - Exonic
1037769179 8:21789021-21789043 GCGGCTGGCGGCGCGGGGCGCGG + Intronic
1038210696 8:25516895-25516917 GCGCTTGGAGGAGCGGGCCACGG + Intergenic
1041686814 8:60652184-60652206 GCGGGTGGCGGCACATGCCGCGG - Intergenic
1043388298 8:79768467-79768489 GCGCTAGGCGGCGGCTTCCGAGG - Intergenic
1057186181 9:93058705-93058727 GCGCTTGGCGGGGTCTGCCAGGG - Exonic
1057665061 9:97038741-97038763 GGGCGCGGCGGCGCGTGCAGAGG - Intronic
1061248542 9:129413810-129413832 GGGCCGGGCGGCGCGGGCCGCGG - Intergenic
1061293659 9:129666026-129666048 GCGGCTGGCGGCGCGCCCCGGGG + Exonic
1062613443 9:137385412-137385434 GGGCTGGGCGGGGCGTGCTGTGG + Intronic
1187163812 X:16786793-16786815 GGGTTTGGCGGCGCGCGGCGGGG + Intronic
1187173108 X:16870465-16870487 GGGGTGGGCGGAGCGTGCCGCGG + Intergenic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic
1198158566 X:133985617-133985639 CCGCTTGGCGGCGCGGGGCAGGG + Exonic
1201063772 Y:10070145-10070167 GCGCTGGGCTGCGCAGGCCGGGG + Intergenic