ID: 1083669974

View in Genome Browser
Species Human (GRCh38)
Location 11:64294211-64294233
Sequence CACTTTCTTGAGTCTATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083669974_1083669980 -6 Left 1083669974 11:64294211-64294233 CCAACCATAGACTCAAGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1083669980 11:64294228-64294250 AAAGTGTTGGCCGGGCACGGTGG 0: 6
1: 69
2: 591
3: 3531
4: 15392
1083669974_1083669979 -9 Left 1083669974 11:64294211-64294233 CCAACCATAGACTCAAGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1083669979 11:64294225-64294247 AAGAAAGTGTTGGCCGGGCACGG 0: 1
1: 10
2: 120
3: 826
4: 4036
1083669974_1083669982 21 Left 1083669974 11:64294211-64294233 CCAACCATAGACTCAAGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1083669982 11:64294255-64294277 TGCCTGTAATCCTAGCACTTTGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
1083669974_1083669984 25 Left 1083669974 11:64294211-64294233 CCAACCATAGACTCAAGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1083669984 11:64294259-64294281 TGTAATCCTAGCACTTTGGAAGG 0: 913
1: 33227
2: 326044
3: 254571
4: 136488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083669974 Original CRISPR CACTTTCTTGAGTCTATGGT TGG (reversed) Intronic
900078141 1:834553-834575 CACTCGCTTGAGACTATGCTGGG - Intergenic
902056877 1:13608280-13608302 CACCTTCTCTTGTCTATGGTAGG - Intronic
906244239 1:44262028-44262050 CACTGTCTGGAGCCTAAGGTTGG - Intronic
906826582 1:48987988-48988010 AGCTTTCTTGAGTGCATGGTGGG - Intronic
910986316 1:93008130-93008152 CACATTCATGAGTCTTTGGGTGG + Intergenic
916747470 1:167695391-167695413 CCCTTTCTTGAGACCATGATTGG - Intronic
917458546 1:175207060-175207082 GATATTCTTGAGTCTATGGCAGG + Intergenic
917650963 1:177077033-177077055 CATTTTCTTGAGTCACTGATAGG - Intronic
919695030 1:200566237-200566259 CTCTTTCTTTACTCTATGGTAGG + Intronic
921087006 1:211803870-211803892 CAGCTTCTTGAGACTGTGGTAGG - Intronic
921627218 1:217390031-217390053 CACGTTCTTGAATCTCTGGGGGG + Intergenic
1064018696 10:11792331-11792353 CATTTTTTTGGGTCTTTGGTCGG + Intergenic
1065988180 10:30978162-30978184 CAGTTTCTTGAATCGATGTTTGG - Intronic
1066079671 10:31917910-31917932 CAATTTCCTGACTTTATGGTGGG + Intronic
1068577726 10:58703274-58703296 CAGCTACTTGAGTCTGTGGTGGG - Intronic
1068625234 10:59238516-59238538 CAATTTATTAAGTATATGGTTGG + Intronic
1069177411 10:65310221-65310243 CACTTTCATGAGAATATGATAGG - Intergenic
1071181957 10:82996690-82996712 CACTTACATTAGCCTATGGTTGG + Intergenic
1071859542 10:89658119-89658141 CACTTACATGAGCCTATAGTTGG - Intergenic
1072945934 10:99809966-99809988 CACTTCCATCTGTCTATGGTGGG + Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078713155 11:13814591-13814613 CACTTACATTAGCCTATGGTTGG - Intergenic
1080349275 11:31364101-31364123 CACTTTCTTTAGCCTACAGTTGG - Intronic
1080809727 11:35691548-35691570 CACTTACATTAGTCTATAGTTGG + Intronic
1080849649 11:36057149-36057171 CAGTTTCCTGAGTCTATCCTAGG - Intronic
1083669974 11:64294211-64294233 CACTTTCTTGAGTCTATGGTTGG - Intronic
1085334022 11:75677341-75677363 CACTTTCATTAGCCTATGGTTGG + Intergenic
1092127673 12:6086264-6086286 CTCTTTCTTGAGTCATTGATAGG - Intronic
1092200257 12:6577665-6577687 CACTTTCTTCATTCTATGGAAGG - Intronic
1095105042 12:38223103-38223125 CACTTTCTTTAGTCAATCCTTGG + Intergenic
1099143102 12:79005193-79005215 CTCTTTCTAAAGTCTATGGCTGG - Intronic
1099567151 12:84266186-84266208 CACTTACATTAGCCTATGGTTGG + Intergenic
1100503903 12:95200962-95200984 TACTTTCTTGAAACTATGTTAGG - Intronic
1100661034 12:96699061-96699083 AACTTACTTCAGTCTCTGGTTGG - Intronic
1104199637 12:126575860-126575882 CACTTTTTTTAATCTATGGCTGG - Intergenic
1105545892 13:21350841-21350863 AACTTTCATTAGCCTATGGTTGG + Intergenic
1108272372 13:48774192-48774214 CATTTTCTTTAGTCTCTGCTGGG - Intergenic
1109323239 13:60835618-60835640 CACCTACTTGAGTCAATGTTTGG + Intergenic
1110016573 13:70413388-70413410 CACTTTCATTAGCCTATGGGGGG + Intergenic
1111856827 13:93648178-93648200 CCCTCTCTTGAGACTATGATGGG + Intronic
1113285862 13:108848494-108848516 AACTTTCTTGAGTTTAAGTTTGG - Intronic
1114349846 14:21837569-21837591 CACTTACATTAGCCTATGGTTGG + Intergenic
1115693438 14:35871084-35871106 CTCTTTCTTGATTGTATGGTGGG + Exonic
1117470875 14:56043281-56043303 CACTTACATTAGCCTATGGTTGG + Intergenic
1118109808 14:62705503-62705525 CATTTTCTTGTGTTTGTGGTAGG + Exonic
1118959848 14:70518957-70518979 CACTTTTTTGAATATATTGTGGG - Intergenic
1119117004 14:72033101-72033123 CACTTACATTAGTCTATGGTTGG + Intronic
1121754024 14:96387973-96387995 CTCTTTCTTGAGTTAATGGTTGG - Intergenic
1122682449 14:103476094-103476116 CACCATCTAGTGTCTATGGTGGG - Intronic
1124088645 15:26577192-26577214 GACCTTCTTGAATCTCTGGTTGG - Intronic
1124808365 15:32908735-32908757 CAAGTTCTTGTGTCTAGGGTGGG - Intronic
1128558651 15:68649868-68649890 CTCTCTCTTGAGTGTATAGTGGG - Intronic
1129493465 15:75952971-75952993 CACTTTCTTGAGGGTATCCTTGG + Intronic
1130435986 15:83900486-83900508 CAATTACTTGAGTCTATCATTGG - Intronic
1133658305 16:7888757-7888779 CACTTTCTAGTGTCAATTGTGGG + Intergenic
1133924985 16:10184784-10184806 TCCTTTCTTGAGTCTATGGCTGG + Intergenic
1137908855 16:52354932-52354954 CACTTTCTTTTGTCTCTCGTAGG + Intergenic
1140094891 16:71866700-71866722 CACTTTCTTGAGTAGCAGGTGGG - Intronic
1140157064 16:72441555-72441577 CACTTTTTAGAGGCTATTGTTGG + Intergenic
1147729428 17:42588901-42588923 CACTTTAGGGAGGCTATGGTGGG - Intronic
1149256420 17:54832326-54832348 CAATTTGATGAGTGTATGGTGGG - Intergenic
1150420356 17:65028433-65028455 CACTTTCTTCCTTATATGGTAGG - Intronic
1159696214 18:71559660-71559682 GATTATCTTGAATCTATGGTGGG - Intergenic
1162284845 19:9730408-9730430 CACTTTCTTGATTCCCTGGCTGG - Intergenic
1162877282 19:13630067-13630089 GACTTGCTTCAGTCAATGGTAGG + Intergenic
1163055791 19:14716589-14716611 CAATTTCTAGAGCTTATGGTTGG - Intronic
1163161456 19:15467021-15467043 CACTTTCTTGTATCTCTGTTAGG + Intergenic
1165708067 19:37990371-37990393 CACTACCTTGAGCCTATGGGAGG + Intronic
1166071146 19:40388799-40388821 CACTTTGTTGAGGCCAAGGTGGG + Intronic
927166956 2:20333286-20333308 CACATTATTGAGGCTATGGTGGG + Intronic
931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG + Intergenic
932105020 2:68934231-68934253 CATTTTCCTCAGTCTATGATTGG - Intergenic
935729776 2:106055788-106055810 CATTTTCTTGTCTCTTTGGTAGG - Intergenic
936947243 2:117941781-117941803 CAGTTTCCTGAGTCTGTGGAAGG - Intronic
937122256 2:119448955-119448977 CACTGTCTAGAGTCCATGGCTGG + Intronic
939566664 2:143793597-143793619 CTCTTCCTTGAGTCTCTGGGGGG + Intergenic
941237711 2:162995961-162995983 CTCTTCCTTGTGCCTATGGTGGG - Intergenic
942237249 2:173922808-173922830 CACTCTCTGGAGTCTATACTAGG - Intronic
942942397 2:181633448-181633470 CACTTTCTTGGGTTTAGGTTTGG + Intronic
943457042 2:188120897-188120919 TACCTTCTTGAGGCAATGGTAGG - Intergenic
944360005 2:198842633-198842655 CATTTTCTTGAGTTGATGATAGG + Intergenic
944627557 2:201587695-201587717 GAGTTTCTTGAATCTATGGATGG + Intronic
945418081 2:209599667-209599689 AAATTTCTGGAGTCTATGGCTGG + Intronic
945557718 2:211300098-211300120 CCCTTTCTTGAGACCCTGGTAGG - Intergenic
1169046165 20:2536202-2536224 CACTATCTTGAGTCCCTGATTGG - Intergenic
1172545591 20:35758899-35758921 CACTTTATTGAGGCTGAGGTAGG - Intergenic
1178668621 21:34570889-34570911 AACTTGCTTGAGTCAATGATTGG - Intronic
1182057568 22:27371826-27371848 CACTTTCTTGAGAACATGGCAGG - Intergenic
1184641740 22:45876651-45876673 CACTTCCTGGAGTCTCTGGCTGG - Intergenic
949690109 3:6627025-6627047 CAATTTCTTGACTTTATGATGGG - Intergenic
953853393 3:46482928-46482950 CACTTTCTTAAGTCTAACTTTGG + Intronic
954449930 3:50566378-50566400 CGTTTTCCTGAGTCTAAGGTGGG + Intronic
956161368 3:66356873-66356895 CACTTGCTGGAGTCTGAGGTGGG - Intronic
957507171 3:81136836-81136858 CACTTTCTGGGGCCTGTGGTGGG - Intergenic
958574734 3:95934192-95934214 CAGTTTCTGCAGACTATGGTGGG + Intergenic
958869318 3:99538496-99538518 CTCTTTCTGGGGTCCATGGTGGG + Intergenic
964008584 3:151861821-151861843 CAGTTTCTTGGGTTTCTGGTAGG - Intergenic
968805443 4:2768844-2768866 CACATTCCTGAGCCTTTGGTGGG - Intergenic
969903813 4:10374305-10374327 CAGTTTCTCAAGTCCATGGTAGG + Intergenic
973123634 4:46556122-46556144 CACTTTCTGGAGTTTATTTTAGG - Intergenic
973646161 4:52953255-52953277 CACATTCTTTACTCTATAGTTGG - Intronic
978459220 4:108931707-108931729 CACTGTGTTGATTCTATGGCAGG + Intronic
979124576 4:116951953-116951975 CACTTTATTTAGTCTATGAATGG + Intergenic
979227929 4:118311296-118311318 CACTCTTTTGGGTCTGTGGTAGG - Intronic
980334422 4:131452111-131452133 CATTTTCTTGAGTGTTTGGGAGG - Intergenic
985765209 5:1774652-1774674 GATTTTCTTGAGTATATGATGGG - Intergenic
987291328 5:16511359-16511381 CACTTACATCAGCCTATGGTTGG - Intronic
989114709 5:37941277-37941299 CATTTTCTTGAGGCTGTGGATGG + Intergenic
990658440 5:57984619-57984641 CACTTACATTAGCCTATGGTTGG + Intergenic
991685707 5:69180502-69180524 AACTTTCTTAAATTTATGGTTGG + Intergenic
991974561 5:72173506-72173528 GACTTTCTTGAGACTAGAGTAGG - Intronic
993393554 5:87353885-87353907 CACTTTCTGAAGTATATGGTAGG + Intronic
993904634 5:93609297-93609319 AAATTTCTTGAGTAAATGGTTGG - Intergenic
995885380 5:116888596-116888618 CACTTACATTAGCCTATGGTTGG + Intergenic
996591108 5:125148774-125148796 CTCTTTCCTGAGTCTAGGGATGG - Intergenic
999664868 5:153902057-153902079 CACAGTCTAGAGTCTATGATGGG + Intergenic
1001335178 5:170790785-170790807 CACTGTGTTCAGTCTGTGGTTGG + Intronic
1001695485 5:173666995-173667017 CACTTTCCTGGGTCTCTGGAAGG - Intergenic
1005029563 6:21496010-21496032 CTCTTTCATGATTCTAAGGTGGG - Intergenic
1006046409 6:31302589-31302611 CACTTTCTTTAGCCACTGGTTGG + Intronic
1006607854 6:35271841-35271863 CACTTTGTTGAGGCTAAGGTGGG + Intronic
1009616851 6:66020225-66020247 CACTTTCTTAAGTCACTGATTGG - Intergenic
1011807350 6:91086940-91086962 CACCTTCTTTAGTCTGTGGGAGG + Intergenic
1013416392 6:109928846-109928868 CAGGTTCTTGAGTTTTTGGTGGG + Intergenic
1017527559 6:155255131-155255153 CACTTACATTAGCCTATGGTTGG - Intronic
1023506698 7:40906952-40906974 CACCTCCTTGAGTCTCTGGGAGG - Intergenic
1026537353 7:71250716-71250738 CACTTTTGTGAGTCAATGATCGG - Intronic
1027585532 7:80053724-80053746 TACTTTCTTGAGACTAGGCTGGG + Intergenic
1032525983 7:132578266-132578288 CACTTCCCTCAGACTATGGTGGG - Intronic
1032650089 7:133868697-133868719 CATTTTCTTGAGTCTATTAGAGG + Intronic
1035527476 8:325117-325139 CACTCGCTTGAGACTATGCTGGG + Intergenic
1040762584 8:50868136-50868158 CAATATATTGAGTCTGTGGTTGG - Intergenic
1041134250 8:54739367-54739389 CAATTTCTTGAGGTTATGATGGG - Intergenic
1041329707 8:56711749-56711771 CACTTCCCTTAGCCTATGGTTGG + Intergenic
1043131043 8:76461778-76461800 CTCTTCCTTCAGTTTATGGTGGG + Intergenic
1043841725 8:85113009-85113031 CACTTACTTCAGTGTATGGTAGG + Exonic
1044328075 8:90883584-90883606 CACTTCCTGGAGTTTAAGGTAGG - Intronic
1044331582 8:90926565-90926587 CTCTCTCATGAGTCTATGGTTGG + Intronic
1045554837 8:103206091-103206113 CAGTTTCCAGAGTCTAGGGTTGG + Intronic
1049787786 8:144459323-144459345 CACCTTCTGGAGTCTCAGGTGGG - Intronic
1052017499 9:23486209-23486231 CACTCTCTTGCCTCAATGGTTGG - Intergenic
1053034593 9:34813802-34813824 CATCTTCTTGAGTCTGTGGGTGG - Intergenic
1057884022 9:98815342-98815364 CACTTCCATTAGTCTATAGTTGG - Intronic
1186168062 X:6848127-6848149 CACTTTCTTGACTCTAAACTAGG - Intergenic
1188300473 X:28501810-28501832 CTCTCTCTTGTGTCTCTGGTAGG + Intergenic
1192211230 X:69129133-69129155 CTCTCTCTTGAGTCTGTGCTTGG + Intergenic
1193982061 X:88193713-88193735 CACTTTGTTGATTCTTTGCTTGG - Intergenic
1194861658 X:99006080-99006102 CACTTACATTAGTCTATAGTTGG - Intergenic
1194916890 X:99718121-99718143 CAGTTGATTGAGTCCATGGTGGG - Intergenic
1195295076 X:103468535-103468557 CACTTTCTTGTTTCTATTCTGGG + Intergenic
1197628022 X:128824822-128824844 CTCTTTTTTGATTCTCTGGTAGG - Intergenic
1198581589 X:138071372-138071394 CACTTTCTGGAGCCTATTCTGGG - Intergenic