ID: 1083671680

View in Genome Browser
Species Human (GRCh38)
Location 11:64303606-64303628
Sequence TAGGCAAATTGGGGGTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083671680 Original CRISPR TAGGCAAATTGGGGGTTGAT AGG Intronic
900748674 1:4379425-4379447 TAGGAGAATTGGGGGTGGAAGGG - Intergenic
902143636 1:14378364-14378386 TTGTTAAATTGGGGGATGATTGG - Intergenic
905332990 1:37220621-37220643 TAGGCCAATTGGCTGTCGATTGG - Intergenic
906920545 1:50059915-50059937 AAGGCAAATTGGTGGTTGCCAGG + Intronic
909521362 1:76572148-76572170 CAGGCAAATGGGGGAATGATTGG + Intronic
912658833 1:111510765-111510787 CAGGCATATTGCAGGTTGATTGG + Intronic
915519121 1:156431029-156431051 TAGGGAGCTGGGGGGTTGATGGG + Intergenic
916014117 1:160733316-160733338 TAGGCAAACAGGAGTTTGATTGG + Intergenic
917315501 1:173720551-173720573 TAGGCACATAGGGGATGGATTGG + Intronic
1064422499 10:15202864-15202886 AAAGCAAAATGGGGGTTGGTTGG - Intergenic
1065932411 10:30491322-30491344 AAGGAAACTTGGGGGTTGAATGG + Intergenic
1066355867 10:34683329-34683351 TAGGTATATTGGGTGATGATGGG - Intronic
1066586692 10:36943903-36943925 TAGGGAAATGGGGGGTTGGTGGG + Intergenic
1067492267 10:46721132-46721154 TAGGTAAATTTGCTGTTGATTGG + Intergenic
1067602395 10:47619252-47619274 TAGGTAAATTTGCTGTTGATTGG - Intergenic
1067851845 10:49759569-49759591 CAGGCAGGTTAGGGGTTGATAGG + Intronic
1067979358 10:51066400-51066422 TGGGCAAATTGTGGTTTGAAAGG + Intronic
1068251053 10:54441291-54441313 TAGGTAAATTTGCTGTTGATTGG - Intronic
1071653750 10:87424662-87424684 TAGGTAAATTTGCTGTTGATTGG - Intergenic
1074020945 10:109582014-109582036 TAGTCAATTTGGGGGCTGAGTGG + Intergenic
1074349095 10:112717394-112717416 TAGGAAAATCAGGGGTTGCTTGG + Intronic
1076945377 10:133645251-133645273 TAATCATATTGGAGGTTGATGGG + Intergenic
1077633542 11:3826845-3826867 TAGGGAAATTGAGGGGTGAGGGG + Intergenic
1078965200 11:16331361-16331383 TAGGCAAACTGGGCCTTGAAAGG - Intronic
1080517903 11:33040240-33040262 TAGACACAGTGGGGGTTGAATGG + Intronic
1083671680 11:64303606-64303628 TAGGCAAATTGGGGGTTGATAGG + Intronic
1084068479 11:66718963-66718985 TAGGTAACTTGGGGCCTGATGGG - Intronic
1086836755 11:91634088-91634110 TCGGAAAACTGGGGGTTGGTGGG - Intergenic
1089040076 11:115439462-115439484 TATGCAAATTGGTGATTCATGGG - Intronic
1090751745 11:129752179-129752201 TAGGCAACTTATGGGGTGATGGG + Intergenic
1091818418 12:3456538-3456560 TTGGTGAATTGGGGGATGATCGG - Intronic
1092246413 12:6866766-6866788 TAGGAAAATTGGGGTTGGGTGGG + Intergenic
1094391409 12:29954501-29954523 GAGGCAATTTGGGGGTTGGAGGG + Intergenic
1102021879 12:109688726-109688748 GGGGCAAACTGGGGGTTGCTTGG - Intergenic
1106501765 13:30335815-30335837 TAGGCATTTTGGGGGGTGCTGGG - Intergenic
1110071925 13:71188742-71188764 TATGCAAATTGGAGGTTGAGGGG - Intergenic
1114094631 14:19322153-19322175 TAGGCAAATTGCATGTTGCTGGG - Intergenic
1114902523 14:27082326-27082348 TAGGTAAATTGGGTGTTGCAGGG + Intergenic
1116158872 14:41240881-41240903 TAGGCAAATTGGGTATTGGTTGG - Intergenic
1120474846 14:84974235-84974257 TAGGCAAGTTTGGGGATGATTGG + Intergenic
1120555032 14:85919290-85919312 GAAACAAATTGGGGGTTGAAGGG - Intergenic
1122408727 14:101515182-101515204 TCAGTAAATGGGGGGTTGATTGG + Intergenic
1122994958 14:105258110-105258132 TAGGGAAATTGGGGATTGAAGGG + Intronic
1125844504 15:42838994-42839016 TGGGCAAATTGTGTGTTGCTGGG + Intronic
1129991797 15:79971832-79971854 AAAGCAAATTGGTGGTTGACAGG + Intergenic
1132068056 15:98749711-98749733 TAGGCAAAATATGGGATGATAGG - Intronic
1132233314 15:100200654-100200676 CAGTCACATTGGGGGTTGGTGGG + Intronic
1133707600 16:8369986-8370008 TAGGTAAATTGGGGGTGAAGAGG + Intergenic
1134217675 16:12328801-12328823 TAGGCAAAGATGGAGTTGATTGG + Intronic
1139173135 16:64654940-64654962 TGGGCAAATTGTGTGTTGCTGGG - Intergenic
1144201599 17:12947236-12947258 TTGGCAATTTGGGGGTTGCTGGG - Intronic
1145996462 17:29107473-29107495 TATGCAAATGGGGGGTTGTGGGG + Intronic
1147758290 17:42782186-42782208 CAGCCAAATTGGGGGGTGAGGGG + Intronic
1147881417 17:43656484-43656506 TAGGCAAATTTGTGGTTGGGCGG + Intronic
1149030326 17:52075502-52075524 TATGCAAAATGGAGTTTGATTGG + Intronic
1155273067 18:24159593-24159615 TAGGTAAATAGAGGGTTGCTTGG - Exonic
1158595854 18:58815327-58815349 GAGGTAAATTGGAGGTAGATTGG - Intergenic
1158810709 18:61030676-61030698 TAGCCAAATGGGGACTTGATTGG - Intergenic
1161902677 19:7131325-7131347 TAAGTAAATTGGGTGTTGTTGGG - Intronic
1166373511 19:42314938-42314960 TGGGCAAGTTGGGGGTTGGCAGG - Intronic
1167525112 19:49978854-49978876 TAAGAAAAGTGGGGATTGATTGG - Intronic
926204755 2:10828265-10828287 AAAGCAAATTGGGGGTAGGTTGG - Intronic
929409303 2:41678653-41678675 TAGGAAAGTTGGGAGTGGATAGG + Intergenic
931891905 2:66682512-66682534 TAGTCACATGGGGGGTTGTTTGG + Intergenic
932556971 2:72833061-72833083 TAGTCAAATTGGTGGTTCATGGG - Intergenic
935625518 2:105169292-105169314 TAAGCACTGTGGGGGTTGATGGG + Intergenic
937194761 2:120143429-120143451 TCGCCAAATTGAGGGTAGATGGG - Intronic
939405939 2:141756092-141756114 TAGGGAATTTGGGAGGTGATAGG - Intronic
941027264 2:160470779-160470801 TAGGCATATGGGGGATTCATAGG - Intronic
941357073 2:164506940-164506962 GAGGCAAATTGGTGATTGCTAGG + Intronic
944680695 2:202074016-202074038 TAGGCAAACTGATGGTTGTTTGG + Intronic
1183064394 22:35353285-35353307 TATGGAATTTGGGGGTTGATAGG - Intergenic
1183550891 22:38484138-38484160 TAGACAAATTTGGGGTTGGGGGG + Exonic
1184010624 22:41745326-41745348 TAGGCTAGTTGGGGGGTGGTGGG - Intronic
955848716 3:63195996-63196018 TGGGCAAATTGGGTATTGAATGG - Intergenic
956389864 3:68759877-68759899 TGGGCAGATGGGGGGTAGATGGG + Intronic
960765716 3:121127795-121127817 TGAGGAAATTGGGGGTTGCTGGG - Intronic
962544849 3:136423322-136423344 TAGAAAAATTGGGTATTGATTGG - Intronic
965550549 3:169960862-169960884 TATGCAAACTGGGAGCTGATAGG - Intergenic
969761420 4:9186634-9186656 GGGGCAAAGTGGGGATTGATAGG + Intergenic
972703022 4:41512715-41512737 AAGGCAAATTAGTGGTTGTTTGG + Intronic
973916502 4:55639166-55639188 TAGGGAAAGTGGGGGCAGATAGG + Intergenic
982682448 4:158447645-158447667 TAGGCAAGTTGGGGGATAAATGG - Intronic
983122691 4:163907540-163907562 TAGGCAAATATGTGGATGATTGG - Intronic
984866635 4:184286135-184286157 ACGGCAAATTGTGGGTTGGTGGG - Intergenic
987599622 5:20050172-20050194 TGGGCAAATTGAGGGTTGAAGGG + Intronic
988373984 5:30409393-30409415 TATGCATATTTGGAGTTGATAGG + Intergenic
988379698 5:30484475-30484497 TATGTAAATGGTGGGTTGATGGG - Intergenic
989328632 5:40229098-40229120 TAGTCTAATTGGGGCTTGACAGG - Intergenic
990417361 5:55599116-55599138 CAGGCCAATTGGGGGTTTTTTGG + Intergenic
992707093 5:79407165-79407187 TAGTCCATTTGGGGGTTGAAAGG - Intronic
995293185 5:110484244-110484266 TGGGTAAATTGTGTGTTGATGGG - Intronic
996443290 5:123514691-123514713 TAGGCAAAATGGGGACTGAGGGG + Intronic
996837996 5:127815416-127815438 TTGGCACATTTGGGGATGATAGG + Intergenic
1011869536 6:91875404-91875426 TTGGCAAATTTGGGATTGTTTGG - Intergenic
1015000825 6:128212741-128212763 TAGGCAATTTGTGTGTTGAGTGG - Intronic
1015297719 6:131616935-131616957 TAGGAAAATAGGGAATTGATTGG - Intronic
1017750759 6:157488408-157488430 AACGCAAATTGAGGGTTGTTTGG - Intronic
1019804871 7:3116356-3116378 AAGGAAAATTGGGGGTGGAGGGG - Intergenic
1023256385 7:38317104-38317126 CAGGCAAATTTGAGGTGGATAGG - Intergenic
1027505582 7:79013818-79013840 TAGGCAAATTGGGAATTATTAGG - Intronic
1032646502 7:133830680-133830702 TAGGGAAAGTGGGGGTATATGGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034254288 7:149715803-149715825 TAGGCAAATTGGATGTTGTTGGG + Intronic
1038621616 8:29148754-29148776 TAGGCAAATTGAGTCTTGGTGGG + Exonic
1045162246 8:99561208-99561230 GAGGCAGATTGGTGGTTGCTAGG - Intronic
1046515274 8:115251404-115251426 TAGGAAAATTTGGGGCTGAGAGG - Intergenic
1055298532 9:74859132-74859154 TAGCCAAAGTGGGACTTGATGGG - Intronic
1058980637 9:110166797-110166819 TAAGCAGATTGTGGGTAGATGGG - Intronic
1060572735 9:124657748-124657770 TAGTCACATTAGGGGTTGCTGGG - Intronic
1189985777 X:46552320-46552342 AAGGCAAGATGGGGGTTGGTTGG - Intergenic
1191962353 X:66717977-66717999 TAGATAAATTGAGGATTGATGGG + Intergenic
1193235526 X:79101924-79101946 AAAGCAAATTGGTGGTTGCTAGG - Intergenic
1197631773 X:128869200-128869222 GAGGCTAATTTGGGATTGATGGG + Intergenic
1199239784 X:145532905-145532927 TAGGTAAATTGTGTGTTGCTAGG - Intergenic