ID: 1083673113

View in Genome Browser
Species Human (GRCh38)
Location 11:64310880-64310902
Sequence GGGTGCACAAAGTTTAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083673113_1083673121 19 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673113_1083673118 8 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673118 11:64310911-64310933 CTGAAGAACAGTGAGCCAGCCGG 0: 1
1: 0
2: 2
3: 24
4: 253
1083673113_1083673122 20 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673113_1083673119 13 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1083673113_1083673120 14 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083673113 Original CRISPR GGGTGCACAAAGTTTAAGAT TGG (reversed) Intronic
901216178 1:7556614-7556636 TGGGGCACAAGGTTTGAGATGGG - Intronic
908685769 1:66717691-66717713 GTATGCATAAAGTTTAAGATTGG - Intronic
909724941 1:78823366-78823388 GGGTGCTTTAAGTTTAAGAAGGG - Intergenic
1062790227 10:299132-299154 GTGTGCACATTGTGTAAGATGGG - Intronic
1065992279 10:31023878-31023900 GGAAGCACAGAGTTTGAGATTGG - Intronic
1066508166 10:36066547-36066569 TGGTGCCCAAAGTTTCAGAGGGG - Intergenic
1066590639 10:36989894-36989916 ATGTGGACATAGTTTAAGATGGG + Intergenic
1068157376 10:53219207-53219229 GAGTGCACAAAGGTTATGTTAGG + Intergenic
1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG + Intronic
1071329217 10:84543713-84543735 AGGGGCCCAAAGTTGAAGATAGG + Intergenic
1074889025 10:117720016-117720038 GGGTGCACAAATTCTAAGGTAGG + Intergenic
1081943406 11:46965022-46965044 GAGTGCACAAATTTTAAGACTGG + Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1087193392 11:95280306-95280328 GATTGCACAAAATTCAAGATGGG + Intergenic
1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG + Intergenic
1097918149 12:65041720-65041742 GGTTACACAAAGTTTAGGTTAGG + Intergenic
1100529597 12:95451444-95451466 GGGTGTCCAAAGTTTAACTTGGG + Intergenic
1101705208 12:107214982-107215004 GGGTGCCCAAAATTTAATTTGGG - Intergenic
1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG + Intergenic
1114145327 14:19969489-19969511 AGGTGCAAAAAGATTAGGATTGG - Intergenic
1115954527 14:38763507-38763529 AGGAGCACAAAGTTAAAGCTAGG - Intergenic
1116336961 14:43668487-43668509 AGGTGCATATAGTATAAGATAGG - Intergenic
1120534513 14:85677231-85677253 GGGTGCTTAAATTTTAAGACTGG + Intergenic
1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG + Intergenic
1125157908 15:36610117-36610139 GGGTTCACAAACTATAATATAGG + Intronic
1126924255 15:53565133-53565155 GGGTACAATAAGTGTAAGATTGG + Intronic
1131977026 15:97957297-97957319 GTGGCCAAAAAGTTTAAGATTGG + Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1139622172 16:68154403-68154425 GGGTGCTGAAAGTTTAAACTAGG - Intronic
1145025825 17:19467173-19467195 GCCTGTACATAGTTTAAGATGGG - Intergenic
1146247626 17:31303608-31303630 GGGGGCACAAATTTTAAAACTGG - Intronic
1147495404 17:40910901-40910923 GGGAAGAAAAAGTTTAAGATGGG - Intergenic
1160087380 18:75789368-75789390 GGGTGCAGAAAGTTCCAGGTTGG + Intergenic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
1167822516 19:51941488-51941510 GGGGGCACAGAGTCCAAGATAGG - Intronic
1167874654 19:52401683-52401705 AGGTTCACAAATTTTAAGAAAGG + Exonic
929089305 2:38198981-38199003 GGGAGCAGAAATTTTGAGATTGG - Intergenic
930364001 2:50416382-50416404 GGGAACACAAAGCTTAAGGTAGG - Intronic
932249562 2:70230878-70230900 GGGTGAATAAAGCTTAAAATTGG - Intronic
943191297 2:184682037-184682059 TGGTGCCCAAAGTTTCAGAGGGG - Intronic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
946352014 2:219161291-219161313 GGTTGTACAAAGTCCAAGATAGG - Intronic
948300294 2:236901252-236901274 GTTTGCACAAAGTTTAAAATAGG + Intergenic
1170394210 20:15908481-15908503 GGGTGTAAAAAGTTTAATATGGG - Intronic
1173953381 20:47011158-47011180 TGGTGCACAACATTGAAGATGGG + Intronic
1175689744 20:61056834-61056856 GGCTGCAGAGAGTCTAAGATAGG - Intergenic
1185017390 22:48352719-48352741 GGGTGCCCAAAGCTGGAGATGGG - Intergenic
949377259 3:3404693-3404715 GAGTGCCCAAAGTATAAGAGGGG + Intergenic
950649572 3:14398844-14398866 GGGTGCACAAAGTGCATCATGGG + Intergenic
951587777 3:24232876-24232898 GGATGCAGATAGGTTAAGATTGG + Intronic
957613631 3:82500720-82500742 GGTTTCACCAAGTTTATGATAGG - Intergenic
960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG + Intronic
961915971 3:130375511-130375533 GGGAGAACAGAGTCTAAGATGGG - Intronic
966550553 3:181199841-181199863 AGGTGCACAGAGTATAAGAGTGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
971412871 4:26393802-26393824 GGGTGCAGAGAGTTTAAAATTGG + Intronic
972899888 4:43669775-43669797 GAGTGCCCAAAGTGTGAGATGGG - Intergenic
973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG + Intergenic
977867620 4:102048748-102048770 AAGTGCACTAAGTTTAAGACTGG + Intronic
984750639 4:183270026-183270048 TGATGAACAAAGTTTAAGAGGGG + Intronic
992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG + Intergenic
992049968 5:72932871-72932893 GGGTGTTCAAAGTTTAACTTGGG - Intergenic
992061955 5:73060543-73060565 TGGGGGACAAAGTTTAAGACTGG - Intronic
994275485 5:97832142-97832164 GGGGGGACAATGTTTAAGCTTGG + Intergenic
996077342 5:119212172-119212194 GCGGGCACAAAGTTTCAGTTTGG - Intronic
996124996 5:119715026-119715048 GGGTACACAAGGTTTACCATGGG - Intergenic
1001054178 5:168435706-168435728 GGGTGAAAAAAGTTTTAGGTCGG - Intronic
1006565076 6:34949214-34949236 GATTTCACAAAGATTAAGATGGG + Intronic
1007017898 6:38487961-38487983 GGGTGCACAAAGTATGAAATAGG + Intronic
1009031237 6:58060793-58060815 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1009177462 6:60478187-60478209 GGGTGCATAAAGGTTTAGAATGG - Intergenic
1009207094 6:60815255-60815277 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1010158348 6:72821971-72821993 GGATGCACGAAGGATAAGATAGG - Intronic
1010938685 6:81890034-81890056 GGATGAAGGAAGTTTAAGATGGG - Intergenic
1025201929 7:56967710-56967732 GCGTGCACACAGATTCAGATAGG + Intergenic
1025670017 7:63609218-63609240 GCGTGCACACAGATTCAGATAGG - Intergenic
1026443666 7:70465375-70465397 AGGTGTACATAGTTTAGGATAGG + Intronic
1029020554 7:97360286-97360308 TGGTGTACAAAGGTTAAGTTTGG - Intergenic
1033728861 7:144153027-144153049 TGGTACACAAACTTTAAGTTAGG - Intergenic
1045794864 8:106030760-106030782 GGGTGGAAAAAGATCAAGATAGG - Intergenic
1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG + Intergenic
1059361776 9:113748807-113748829 GGGTCCACATGGTTTAAGAGGGG - Intergenic
1059779150 9:117508201-117508223 GGGGGCAGAATGATTAAGATGGG + Intergenic
1187124026 X:16436602-16436624 GGGGGCACATAGTCTAAGCTTGG + Intergenic
1188764144 X:34070464-34070486 GGGCACACCAAGTTTATGATGGG + Intergenic
1188979771 X:36716568-36716590 GGGTGCAGCAAGAATAAGATAGG + Intergenic
1189222759 X:39386407-39386429 GGGTACACACAGTTGAAGACAGG - Intergenic
1193290149 X:79762879-79762901 GAGTGCCCAAAGTATAAGAGGGG - Intergenic
1198373095 X:136011037-136011059 TAGAGCACAAAGTTTAAAATCGG - Intronic
1199179611 X:144838413-144838435 CTGACCACAAAGTTTAAGATAGG + Intergenic