ID: 1083673118

View in Genome Browser
Species Human (GRCh38)
Location 11:64310911-64310933
Sequence CTGAAGAACAGTGAGCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083673111_1083673118 18 Left 1083673111 11:64310870-64310892 CCAAAATCCACCAATCTTAAACT 0: 1
1: 0
2: 0
3: 23
4: 286
Right 1083673118 11:64310911-64310933 CTGAAGAACAGTGAGCCAGCCGG 0: 1
1: 0
2: 2
3: 24
4: 253
1083673112_1083673118 11 Left 1083673112 11:64310877-64310899 CCACCAATCTTAAACTTTGTGCA 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1083673118 11:64310911-64310933 CTGAAGAACAGTGAGCCAGCCGG 0: 1
1: 0
2: 2
3: 24
4: 253
1083673113_1083673118 8 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673118 11:64310911-64310933 CTGAAGAACAGTGAGCCAGCCGG 0: 1
1: 0
2: 2
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083673118 Original CRISPR CTGAAGAACAGTGAGCCAGC CGG Intronic
900102326 1:967158-967180 CAGATGAGCAGCGAGCCAGCCGG + Intronic
900772102 1:4553545-4553567 CTTCAGAACAGTGAGGCAGCTGG - Intergenic
900772353 1:4555365-4555387 ATAAAGAAAAATGAGCCAGCCGG + Intergenic
900785419 1:4646709-4646731 ATGCAGAACAGAGACCCAGCTGG - Intergenic
902199733 1:14824294-14824316 CAGAGGAAGAGTGAACCAGCAGG + Intronic
902642371 1:17775065-17775087 CTGCAGAAGGCTGAGCCAGCAGG - Intronic
903972918 1:27130836-27130858 CTGAGGACCAGAGTGCCAGCAGG - Intronic
904126514 1:28243934-28243956 CTGGAGCAGAGTGAGCAAGCAGG + Intronic
904809093 1:33151611-33151633 CTGTAGAATAGTGAGCCCCCAGG - Intronic
904876900 1:33662344-33662366 CTGAAGCACAGGGAGCAAGGAGG - Intronic
906190285 1:43894518-43894540 CTGAAGGACAGGGAGACAGTCGG - Intronic
907247034 1:53115061-53115083 CTGGAGCACTGTGAGGCAGCTGG - Intronic
907298258 1:53469494-53469516 CTGAAAACCAGTAAGCCAGGGGG - Intergenic
908868042 1:68574544-68574566 CTCAAGAACAATGAGCCAAATGG + Intergenic
909154660 1:72058067-72058089 CTGAAGAACACTGACCTAACAGG + Intronic
909727864 1:78857483-78857505 ATGGAGAACTGTGTGCCAGCTGG - Intergenic
910927167 1:92409491-92409513 CTGAAGAAAAGTGAAACAGTAGG + Intergenic
911088059 1:93996032-93996054 CTCAAGCCCAGTGAACCAGCTGG + Intronic
912117380 1:106423367-106423389 CTGAATAACAGTGAGAAAGTGGG - Intergenic
912884679 1:113457965-113457987 CTGAAGAACAGTGAACTAAGTGG + Intronic
913068196 1:115276472-115276494 CTGTCCAACAGTGAGCCAGATGG + Intergenic
914976883 1:152374026-152374048 CTGAAGCACAGTGAGTGAGAGGG + Intergenic
915299944 1:154946130-154946152 CAGGAGGACAGGGAGCCAGCAGG - Exonic
915898333 1:159828396-159828418 CTGGAGGACAGTGAGGCAGAGGG + Intronic
917503570 1:175607685-175607707 GTGAAGAACAGTACGCCAGAGGG + Intronic
918565516 1:185925877-185925899 CTGAAGCCCATTGAGCCAGGAGG + Intronic
919248299 1:195017304-195017326 CTGAATAATAGTGAGCAAGAGGG - Intergenic
919589383 1:199481567-199481589 GAGAAGAACAGGCAGCCAGCTGG - Intergenic
919730970 1:200913364-200913386 CTGAAGAACAGAGAGCATCCTGG + Intronic
919796378 1:201323704-201323726 CTGAAGAACAGTTGGCCGCCTGG - Intronic
922548334 1:226475104-226475126 CTGAATAAATGTGAGCCAGCTGG + Intergenic
924920788 1:248627064-248627086 CTGGTGAACAGTGAGGCTGCCGG - Exonic
1062808050 10:439372-439394 CTAAAGAACACAGTGCCAGCGGG - Intronic
1064260762 10:13784292-13784314 CTGAAGAACAGAAGCCCAGCAGG - Intronic
1064453290 10:15463371-15463393 CTGAAGAACAGTGAGAAATGAGG - Intergenic
1066123258 10:32312122-32312144 CTGAAGCACAGTGAGTGAGGTGG + Intronic
1067834563 10:49630237-49630259 CAGAAGAACAGGGAGCCTGGAGG + Intronic
1068290877 10:55000373-55000395 CTGACCACCAGTGAGCCAGGCGG - Intronic
1069591413 10:69644489-69644511 CTGAAGGCCAGTGAGGCAACGGG + Intergenic
1071015908 10:80997041-80997063 CTTAGGAACTGTGAGTCAGCTGG - Intergenic
1071124947 10:82322950-82322972 CTGAATAACAGTACGCCAGACGG - Intronic
1072396395 10:95047192-95047214 CTGCAGAACCGTGAGCCAATTGG + Intronic
1074494717 10:113969669-113969691 CTGACCACCAGTGAGCCAGGTGG - Intergenic
1075495796 10:122917494-122917516 CGGCAGGACAGTGACCCAGCTGG + Intergenic
1077840580 11:5970464-5970486 CGGGAGGACAGGGAGCCAGCAGG + Intergenic
1078900320 11:15636036-15636058 CTGAAGGTCACAGAGCCAGCTGG - Intergenic
1080984266 11:37442975-37442997 CTGAAGAACAGTGAGCAAATAGG + Intergenic
1082272402 11:50185721-50185743 CTAAAGAACACTGAACCAGAGGG - Intergenic
1082947075 11:58771991-58772013 CTGGAGGACAATGAGCCTGCAGG + Intergenic
1083586934 11:63866982-63867004 CTGAAGAGCTGTGAACCTGCTGG + Intronic
1083673118 11:64310911-64310933 CTGAAGAACAGTGAGCCAGCCGG + Intronic
1087029575 11:93689406-93689428 CTGAGAAACAGCGAGCAAGCTGG - Intronic
1087875092 11:103345648-103345670 CTGAAGCACAGTGAGGGAGAAGG + Intronic
1090806710 11:130207253-130207275 TTTAAGAATTGTGAGCCAGCGGG + Intronic
1091061489 11:132467176-132467198 CTGCAGAACAATGAGCCTTCAGG - Intronic
1091224157 11:133947488-133947510 CTTAAAGACAGAGAGCCAGCTGG + Intronic
1091414301 12:267778-267800 CTGATGAACAGTTAGTGAGCAGG + Intergenic
1092033309 12:5308137-5308159 CTGGAGAACAGTCAGCCATAGGG - Intergenic
1095458734 12:42418541-42418563 CTGCAGAACAGTGAGCCATGAGG - Intronic
1099117725 12:78648638-78648660 CTGACCACCAGTGAGCCAGGCGG + Intergenic
1100599045 12:96097110-96097132 CTGAAGCAGAGTGAGCAAGATGG + Intergenic
1100939288 12:99707949-99707971 CTGAAGAACAATGAGCCAAATGG + Intronic
1101168561 12:102063908-102063930 CTGAAGCAGAGTGAGCAAGGTGG + Intergenic
1101349547 12:103916157-103916179 CTGAAGAACTGAGAACCAGAAGG + Intergenic
1101446150 12:104738166-104738188 CTGAAGAAGGATGAGCCCGCGGG - Intronic
1101855374 12:108438106-108438128 CTGCTGGGCAGTGAGCCAGCAGG - Intergenic
1102696012 12:114799987-114800009 GTGAAGAACAGGGGCCCAGCTGG + Intergenic
1105604217 13:21913389-21913411 CAGAATAACCTTGAGCCAGCTGG + Intergenic
1107156666 13:37175239-37175261 ATGAAGAACACTGAGCCTGCTGG + Intergenic
1112091999 13:96091579-96091601 GGGAAGAACAGAGACCCAGCGGG - Intronic
1112312349 13:98330176-98330198 CTGGAGAGGAGTGAGCCAGAGGG + Intronic
1112437357 13:99399832-99399854 CTGACAAACAGTGAGGCGGCGGG - Intergenic
1116788370 14:49312664-49312686 CTGAAGAAGAGAGAGCCCACTGG + Intergenic
1117351618 14:54886703-54886725 CTGAAGAAGAGCCAACCAGCCGG + Intronic
1117379575 14:55147216-55147238 CTGCAGATCAGTGAGCCAGCAGG - Intergenic
1119199126 14:72740154-72740176 CTGGAGCACGGTGAGCCAGGGGG + Intronic
1120013933 14:79448898-79448920 GTGAGGGAAAGTGAGCCAGCAGG + Intronic
1120115171 14:80607965-80607987 TTGAAGAGCAGAAAGCCAGCAGG - Intronic
1122145428 14:99685791-99685813 CAGAAGGGCAGAGAGCCAGCAGG - Intronic
1122544795 14:102516586-102516608 TTGAAGAGCAGTGAGTCAGAAGG + Intergenic
1122825959 14:104370562-104370584 CTGAAGGACACTGGCCCAGCTGG - Intergenic
1124018042 15:25894772-25894794 CGGGAGCACAGTGAGCGAGCAGG - Intergenic
1126154904 15:45556870-45556892 CTGAAGAAGAGTGAGTCTGTGGG + Intergenic
1126406419 15:48327448-48327470 CAGAAGGACAGTGATCCAGATGG + Intergenic
1127888336 15:63224123-63224145 TTGTAGAACAGTCTGCCAGCTGG + Intronic
1129012790 15:72438233-72438255 TTGAAGAAAAGTGAGCCAAAGGG - Intergenic
1130192482 15:81750196-81750218 CTGAACATCCCTGAGCCAGCCGG + Intergenic
1130948320 15:88566250-88566272 CTGAAGCACAGAGAGTCAGGTGG + Intergenic
1134363817 16:13557828-13557850 CTGGAGAGGAGTGAGCCAGGGGG - Intergenic
1134675456 16:16086980-16087002 CTGAAGAACAAGGTGCCTGCTGG + Exonic
1135121849 16:19773105-19773127 CTGGAGAGCAGTGAACCAGGAGG + Intronic
1136771897 16:32847539-32847561 GTGAAGAGCAGTGAGCCCTCAGG - Intergenic
1138158082 16:54724845-54724867 CTGAAGAACAGTGGGGAGGCTGG - Intergenic
1138653275 16:58473972-58473994 CTGGAGCAGAGTGAGCCAGGAGG - Intronic
1140127163 16:72127385-72127407 CTGAAAAACATGGAGTCAGCAGG + Intronic
1140275508 16:73505075-73505097 GTGAAGCACACTGAGGCAGCTGG + Intergenic
1141072848 16:80973694-80973716 CTGGAGCACAGTGAGCAAGGGGG - Exonic
1141367596 16:83457670-83457692 CTGAAAGACAGGGAACCAGCAGG + Intronic
1203074317 16_KI270728v1_random:1109628-1109650 GTGAAGAGCAGTGAGCCCTCAGG - Intergenic
1143864918 17:9916851-9916873 CTGGAGACAAGGGAGCCAGCTGG + Exonic
1146297130 17:31659050-31659072 CTGAAGATCAGAGTGCCAGCAGG + Intergenic
1146353131 17:32112599-32112621 CTGAGGAACGGCGACCCAGCAGG - Intergenic
1146827131 17:36032583-36032605 CTGGAGTCCAGTGATCCAGCTGG + Intergenic
1147043264 17:37734096-37734118 CTGAAGGCCAGTGAGCCAAAGGG - Intronic
1148693961 17:49548194-49548216 GTGCAGAACAGTGAGGCAGTGGG - Intergenic
1148874370 17:50677986-50678008 CTGAACACCAGAGAGCCTGCTGG - Intronic
1150019962 17:61601753-61601775 CTGGAGCTCAGTGAGCCGGCGGG - Intergenic
1151818066 17:76481339-76481361 CGGCAGAACAGTGAGCCCCCAGG + Intronic
1152322691 17:79617020-79617042 GTGAAGAGCGGAGAGCCAGCCGG - Intergenic
1154130087 18:11729338-11729360 CCTAAGCACAGTGAACCAGCTGG + Intronic
1156161316 18:34361707-34361729 CTGGAGGACAGTGAGCCAATAGG - Intergenic
1156524883 18:37757636-37757658 CTACAGAACTGTGAGCCAACAGG + Intergenic
1156797739 18:41068735-41068757 CTGTAGCACAGTGAGGCAGGAGG - Intergenic
1157403850 18:47407641-47407663 CTGAAGAAGAGGGAGGCAGGAGG - Intergenic
1159123096 18:64192746-64192768 TGGAAGAACAGTGAGCAAACTGG + Intergenic
1161488307 19:4547812-4547834 CTGGAGCACAGTGAGCAAGGGGG - Intronic
1161552773 19:4923344-4923366 CTGGAGAGCAGGCAGCCAGCAGG - Intronic
1161998725 19:7730338-7730360 CTCCAGAACAGTGAGCGAGACGG - Exonic
1162482330 19:10935374-10935396 CTGAAGTACAGTGAGACCTCTGG - Intergenic
1162485526 19:10958207-10958229 CTGAGGATCAGAGAGCTAGCAGG + Intergenic
1163241340 19:16065746-16065768 TTAATGAACAGTGAGGCAGCTGG + Intergenic
1164365621 19:27579086-27579108 CTGATCACCAGTGAGCCAGGTGG + Intergenic
1164529344 19:29036373-29036395 CCAAAGAACAGTGTGCCAGTGGG + Intergenic
1164855125 19:31514799-31514821 CTGAAGAACAGTGAAGTAGCTGG - Intergenic
1164915328 19:32047363-32047385 CTGAAGAACACTGCCCCAGCGGG + Intergenic
1167240627 19:48341099-48341121 TTGAAAACCAATGAGCCAGCAGG + Intronic
925656288 2:6152991-6153013 CTAAAGAAAAGTGAGCCACTGGG + Intergenic
926222223 2:10943709-10943731 GTGTAGAGCAGTGAGCCAGGAGG + Intergenic
926444108 2:12923083-12923105 CTGATCAGCAGTGAGCCAGGAGG - Intergenic
926838226 2:17048426-17048448 CTCAAAAACAGCAAGCCAGCAGG - Intergenic
928114927 2:28539804-28539826 GTGAAGAACAGTGAGCGGGGAGG + Intronic
928457790 2:31439235-31439257 CTTAACAACAGTGAGCCTTCCGG + Intergenic
931795875 2:65709408-65709430 CTAGAGAACAGTGAGCAAGGGGG + Intergenic
932110506 2:68995006-68995028 CTGAAGACCAGTGGCCAAGCTGG + Intergenic
937012568 2:118575348-118575370 CTGGAGAAAAGTGAGCCACCGGG + Intergenic
937477695 2:122229722-122229744 TTGAAGGACAGGGAGCCTGCAGG - Intergenic
938124564 2:128662653-128662675 CTCCAGAACAAAGAGCCAGCTGG + Intergenic
938947962 2:136230931-136230953 CTGAAGACCAGGGAGCCTGGGGG + Intergenic
939246138 2:139625719-139625741 CTGACCACCAGTGAGCCAGGTGG - Intergenic
939901047 2:147849825-147849847 CTTAAGAACAGTGAGTCTGGTGG - Intronic
943727024 2:191262303-191262325 CTGCATAAAAGTGGGCCAGCTGG - Intronic
944369544 2:198965956-198965978 CTGCTGAACTGTCAGCCAGCTGG - Intergenic
945374024 2:209057916-209057938 CTGAAGGAAAGTCAGCCAGGTGG + Intergenic
946881191 2:224178733-224178755 CTGAAGACCAGAGAGCCAGCAGG - Intergenic
947880107 2:233501269-233501291 CTGAAGCACAGTGAGTAAGAGGG + Intronic
948288499 2:236806376-236806398 CTGAAGAACAGGGGCACAGCGGG + Intergenic
948502209 2:238403813-238403835 CTGAGCACCAGGGAGCCAGCAGG - Intergenic
948685947 2:239669864-239669886 CTGAAGAACACTGGGCAAGTTGG + Intergenic
1169091413 20:2863349-2863371 CTGAAGTACAGGGCGTCAGCAGG + Exonic
1171754208 20:29086583-29086605 CTGAAGAACACTGAACCACCGGG - Intergenic
1172124913 20:32619788-32619810 CTGGAGCACAGCGAGCCAGCGGG + Intergenic
1173325113 20:42026177-42026199 CTAAAGAACAGTGAGGGAGCAGG + Intergenic
1173598688 20:44277456-44277478 CTGGAGAAGAGTGAGGAAGCGGG + Intronic
1173673346 20:44812891-44812913 CTGAAGCCGAGTGAGCCACCGGG - Intergenic
1173763190 20:45583226-45583248 CTGAAGAACAGCACGGCAGCGGG + Intergenic
1174375036 20:50120913-50120935 CTAAAGAACAGTGAGCACACAGG + Intronic
1176112002 20:63415246-63415268 CTGAAGAACAGCCAGCCACACGG + Intronic
1177488155 21:21785810-21785832 CTGAAAAGTAGTGTGCCAGCAGG + Intergenic
1179583604 21:42360884-42360906 CTGCTCCACAGTGAGCCAGCAGG + Intergenic
1181171141 22:21010891-21010913 CAGAGGAACAGTGAGCATGCGGG - Intronic
1181909964 22:26230859-26230881 CTGAAGTATAGTGAGCCATGGGG + Intronic
1182894330 22:33846561-33846583 CTGACCAACGGTGAGCCAGGTGG + Intronic
1183171374 22:36190640-36190662 CTGACCAACAGTGAGCCTGGTGG - Exonic
1183393372 22:37558711-37558733 CATCAGGACAGTGAGCCAGCAGG - Intergenic
1185261468 22:49867345-49867367 CTGAAGAAGCGTGTGCCAGGCGG + Intronic
949819105 3:8095923-8095945 CAGAAGACAACTGAGCCAGCAGG + Intergenic
950428466 3:12937462-12937484 CTGAAGCTCAGTGACCCATCTGG - Intronic
950660288 3:14462993-14463015 CTGAAGAACAGAAAGCAGGCCGG + Intronic
952726454 3:36591482-36591504 CTGAAGAACAATGAAGCTGCCGG + Intergenic
955793048 3:62607911-62607933 CTGAAGGGCATTTAGCCAGCTGG - Intronic
957156432 3:76550815-76550837 CTGAAGAAGGCTGAGGCAGCAGG - Intronic
957854830 3:85860956-85860978 CTGAAGCAGAGTGAGCTAGGGGG + Intronic
961066392 3:123880723-123880745 CTGAAGTACAGTGAGCAGGAGGG + Intronic
962311750 3:134331717-134331739 CTGCAGAGCTCTGAGCCAGCAGG - Intergenic
962324849 3:134424276-134424298 GTGAGGAAGAGTGTGCCAGCAGG - Intergenic
962741364 3:138364685-138364707 CTGAGGACCAGTGAGGAAGCTGG - Intronic
963270460 3:143281115-143281137 CTGAAACACAGGAAGCCAGCAGG + Intronic
963730153 3:148963417-148963439 CTGGAGAAAAGTGAGCAAGGTGG + Intergenic
969361634 4:6667753-6667775 CTAAAGAAGAGTGAGGCATCTGG - Intergenic
969493545 4:7513297-7513319 CTGTTGACCAGTGAGCCAGGGGG - Intronic
971183514 4:24352235-24352257 CTGAAGAACAAGGTGCAAGCTGG + Intergenic
972912637 4:43836913-43836935 CTGAAGGACAGAGATACAGCTGG - Intergenic
973852364 4:54973831-54973853 CTGAGGGACAGCCAGCCAGCTGG + Intergenic
975706578 4:77117885-77117907 CTGAAGAACTCTGGCCCAGCTGG + Intergenic
977184914 4:93924979-93925001 TAGAAGAACTGTGAGCCAGTGGG - Intergenic
978606530 4:110486400-110486422 CTAAAGAACACTGAACCAGACGG - Intronic
978954031 4:114594101-114594123 CTCGAGAACAATGAGCCTGCAGG - Intergenic
979253209 4:118586614-118586636 CTCAGGAGCTGTGAGCCAGCTGG + Intergenic
979452814 4:120892717-120892739 CTGAGAAACAATGAGACAGCAGG - Intronic
980250044 4:130303207-130303229 CTGGAGAACAGAGAGACAACTGG + Intergenic
984801184 4:183718499-183718521 CTGAAGACCAGTGGTCCAGCAGG + Intergenic
985330085 4:188822599-188822621 CTGTGGAACAGTGAGACAACAGG + Intergenic
986735282 5:10663424-10663446 CTGATGGAAAGTGAGCCAGTGGG - Intergenic
987014536 5:13804698-13804720 CTGAAGAACAGTGGGGAATCTGG + Intronic
987708421 5:21482739-21482761 TTGAGGAACTGTGGGCCAGCTGG + Intergenic
988751189 5:34191406-34191428 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
989317848 5:40103321-40103343 CTGACCACCAGTGAGCCAGGTGG + Intergenic
991441384 5:66653570-66653592 CTGCTGAACAGAGAGCAAGCTGG - Intronic
991736327 5:69633330-69633352 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991736676 5:69634959-69634981 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991736848 5:69635775-69635797 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991758215 5:69899368-69899390 TTGAGGAACTGTGGGCCAGCTGG + Intergenic
991758389 5:69900184-69900206 TTGAGGAACTGTGGGCCAGCTGG + Intergenic
991758566 5:69901000-69901022 TTGAGGAACTGTGGGCCAGCTGG + Intergenic
991812823 5:70488969-70488991 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991813173 5:70490604-70490626 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991815781 5:70509446-70509468 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991816129 5:70511075-70511097 CTGAGGAACTGTGGGCCAGCTGG - Intergenic
991816305 5:70511885-70511907 TTGAGGAACTGTGGGCCAGCTGG - Intergenic
991837618 5:70775250-70775272 TTGAGGAACTGTGGGCCAGCTGG + Intergenic
991837795 5:70776066-70776088 TTGAGGAACTGTGGGCCAGCTGG + Intergenic
992489007 5:77222753-77222775 ATGAAGAACTGTGAGCCTGAGGG + Intronic
993300141 5:86198582-86198604 TTAAAGAACAGTGAGAAAGCTGG + Intergenic
997030148 5:130118044-130118066 CTGAAAAACAGGGAGCAAGAGGG - Intronic
998084928 5:139312479-139312501 CTGATGATTAGAGAGCCAGCTGG + Intronic
998258987 5:140613612-140613634 CTCAAGAACATTGCTCCAGCAGG + Intergenic
998885711 5:146691750-146691772 CTGGAGCACAGTGAGTGAGCAGG - Intronic
999771184 5:154776764-154776786 CTGTAGATCAGTGAGCTAGCAGG - Intronic
999858556 5:155620967-155620989 CTGAAGATCAGTCTGGCAGCAGG + Intergenic
1000186618 5:158864824-158864846 CTGCAGCACAGTGAGCGAGGAGG + Intronic
1001416239 5:171546351-171546373 CTGAAGAACAGAGACCCATGTGG - Intergenic
1002327464 5:178419181-178419203 CTGAGGGACAGAGGGCCAGCAGG - Intronic
1004155634 6:13165592-13165614 CTGAAGAAAAATGAAGCAGCAGG + Intronic
1004816002 6:19312371-19312393 CTGAAGAACAGCAAGCCAGATGG + Intergenic
1007262744 6:40575258-40575280 CAGGAGCACAGTGAGCCAGTGGG - Intronic
1007505868 6:42334897-42334919 ATGAAGCTCAGTGAGCCAGGAGG - Intronic
1008321800 6:50123027-50123049 ATGAAGCACAGTGAGCTAGTAGG - Intergenic
1008694521 6:54018801-54018823 CTGAAGAGAAGTCAGGCAGCTGG - Intronic
1011328132 6:86173353-86173375 CTGCAGTATAGTGAGCAAGCAGG - Intergenic
1011401851 6:86971337-86971359 CTGAAGAACAGTGAGGCTACAGG - Intronic
1013374550 6:109501816-109501838 CTGAAGAGCTGAGAGCCAGCTGG + Intronic
1015021278 6:128478939-128478961 CTGAGGAAGAGTCAGCCAGCTGG - Intronic
1015062625 6:128985161-128985183 CTGAAGAAAAGTGGGTCAGATGG + Intronic
1015185900 6:130415187-130415209 CTGAGGAACAGAGGGCAAGCAGG + Intronic
1017340605 6:153317297-153317319 CTGCAGAACAGGGAGGCAGGTGG + Intergenic
1018854578 6:167666437-167666459 CTGATGTACACAGAGCCAGCCGG + Intergenic
1018932753 6:168252611-168252633 CTGAAGGACCTGGAGCCAGCTGG - Intergenic
1019005806 6:168795457-168795479 CTGAAGAAAAGGGAACCAGGAGG - Intergenic
1020079008 7:5276552-5276574 TTGCAGACCAGGGAGCCAGCTGG - Intronic
1021620989 7:22550767-22550789 GTGAAGAACAGTGAGGTAGGAGG - Intronic
1022539623 7:31123666-31123688 CTGAAGGGCAGTGAGGAAGCGGG - Intergenic
1022600916 7:31758860-31758882 TTGAAGAGCAGTGAATCAGCTGG - Intronic
1023791489 7:43757292-43757314 CTGGAGCAGAGTGAGCCAGTGGG + Intergenic
1025199888 7:56955626-56955648 TTGCAGACCAGGGAGCCAGCTGG + Intergenic
1025672058 7:63621306-63621328 TTGCAGACCAGGGAGCCAGCTGG - Intergenic
1026466248 7:70657454-70657476 CTGAAAAACAGAGAGAGAGCTGG + Intronic
1029535588 7:101155425-101155447 CTGCAGAACAGACAGCAAGCTGG - Intronic
1031347658 7:120689027-120689049 CTGAAGAACAGTGATGCAGAGGG - Intronic
1032191466 7:129768317-129768339 CTTAAGAACAGAGAGCAGGCCGG + Intergenic
1032831751 7:135634221-135634243 CAGAATATCTGTGAGCCAGCTGG - Intronic
1034188757 7:149197843-149197865 CTGAAGCACAGGGAGGCAGCTGG - Intronic
1035996668 8:4554983-4555005 CTGAGGAACACAGAGCCAGAAGG + Intronic
1037359857 8:18061794-18061816 CTGAAGTACAGTGAGCGACAGGG - Intronic
1040877217 8:52166369-52166391 CAGAAGAACAGTGCCCCAGAGGG - Intronic
1042166385 8:65950025-65950047 CTGAAGTATAATGAGCCAGGTGG + Intergenic
1044618235 8:94163864-94163886 GTGCAGAGCAGTGAGCCAGTGGG - Intronic
1044843156 8:96355206-96355228 CTGATGGGCACTGAGCCAGCAGG - Intergenic
1046235319 8:111416577-111416599 CTGACAAGCAGCGAGCCAGCAGG - Intergenic
1046618629 8:116503907-116503929 CTGCAGCACAGTGAGCGAGCAGG + Intergenic
1046782514 8:118230792-118230814 CTGCAGCACAGTGAGCGAGCGGG + Intronic
1047882847 8:129215651-129215673 CTGAAGAACCGAGAGACTGCTGG - Intergenic
1048810834 8:138284556-138284578 CTGGAGAACAGTGAGCTGGAAGG - Intronic
1051549950 9:18316554-18316576 CTGACCACCAGTGAGCCAGGCGG - Intergenic
1052237514 9:26229685-26229707 TTTAAGAAAAATGAGCCAGCAGG + Intergenic
1052278696 9:26707890-26707912 TTCAAGATCAGGGAGCCAGCAGG + Intergenic
1052807310 9:33024916-33024938 CTCGAGTACAGTGACCCAGCGGG - Intronic
1052983595 9:34468164-34468186 CTGAAGAACAGAGAGGAAGAAGG + Intronic
1053469667 9:38337296-38337318 CAGAAGGAGAGAGAGCCAGCAGG + Intergenic
1053725749 9:40998573-40998595 CTAAAGAACACTGAACCACCGGG - Intergenic
1055400397 9:75917478-75917500 CTGAAGAACCGTGTGTCACCTGG + Intronic
1059836561 9:118161141-118161163 CTGCAGAAGAGTAAGCCAGAGGG - Intergenic
1062090147 9:134671864-134671886 GGGAAGAACAATGAGCCAACAGG + Intronic
1190458559 X:50647897-50647919 CTGGAGCACAGTGAGCAAGGTGG + Intronic
1192214238 X:69147223-69147245 CTGAGAAACACTGAGCCAGGAGG - Intergenic
1196134555 X:112194108-112194130 CTGGAGAGCAGAGAGCTAGCAGG - Intergenic
1197829650 X:130627817-130627839 CTGAATCACAGTGAGAGAGCAGG + Intronic
1198860759 X:141067128-141067150 CTGGAGAACTGTGAACAAGCTGG - Intergenic
1198901933 X:141520258-141520280 CTGGAGAACTGTGAACAAGCTGG + Intergenic
1199808058 X:151321042-151321064 ATGAAAAACAGTGAGGAAGCCGG - Intergenic
1200960711 Y:8993443-8993465 CTGGAGCACAGTGAGCCTACTGG - Intergenic