ID: 1083673119

View in Genome Browser
Species Human (GRCh38)
Location 11:64310916-64310938
Sequence GAACAGTGAGCCAGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083673114_1083673119 -7 Left 1083673114 11:64310900-64310922 CCCTTCCCACTCTGAAGAACAGT 0: 1
1: 0
2: 3
3: 22
4: 254
Right 1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1083673115_1083673119 -8 Left 1083673115 11:64310901-64310923 CCTTCCCACTCTGAAGAACAGTG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1083673111_1083673119 23 Left 1083673111 11:64310870-64310892 CCAAAATCCACCAATCTTAAACT 0: 1
1: 0
2: 0
3: 23
4: 286
Right 1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1083673112_1083673119 16 Left 1083673112 11:64310877-64310899 CCACCAATCTTAAACTTTGTGCA 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1083673113_1083673119 13 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083673119 Original CRISPR GAACAGTGAGCCAGCCGGCC AGG Intronic
900216281 1:1483492-1483514 CACCAGTGAGCCACCAGGCCTGG - Intronic
900995524 1:6121379-6121401 GAAAAGGGAGCCAGGAGGCCTGG + Intronic
901534435 1:9873064-9873086 GCACAGAGAGCCACCCTGCCTGG - Intronic
902126138 1:14213246-14213268 GAACAGTGAGCCAGCAACCAAGG - Intergenic
902199735 1:14824299-14824321 GAAGAGTGAACCAGCAGGGCAGG + Intronic
905294398 1:36945058-36945080 GAACAGTGTGGCCGACGGCCAGG - Intronic
905598565 1:39230447-39230469 GACCAGTGAGCCATCAGTCCTGG - Intronic
908360412 1:63363690-63363712 CAGCCGTGAGCCAGCGGGCCTGG + Intergenic
910110047 1:83673251-83673273 CAAGAGTGAGCCAGCATGCCTGG + Intergenic
917119832 1:171635837-171635859 GAAGGGAGAGCCAGCCAGCCAGG - Exonic
918135392 1:181669351-181669373 GAACAGTGAGCCGTGTGGCCAGG - Intronic
919271812 1:195358536-195358558 GAAGCGTGAGCCATCCTGCCCGG - Intergenic
920193967 1:204213814-204213836 GGAGAGAGAGCCAGCCGGCAGGG + Intronic
920381285 1:205536000-205536022 GCACAGTGAGCCAGGCAGCATGG + Intergenic
920500583 1:206482633-206482655 GAGCAGGGAGCCAGAGGGCCAGG + Intronic
921031836 1:211340972-211340994 CAACAGTGAGCCACCGCGCCTGG + Intronic
924900232 1:248389888-248389910 GACCAGTGGACCACCCGGCCTGG - Intergenic
1063185498 10:3646970-3646992 GATCTGTGAGCTAGCCAGCCTGG - Intergenic
1063486185 10:6423241-6423263 GAACAATGAGTCAGCCAGCCTGG + Intergenic
1065130982 10:22620184-22620206 TGACAGTGGGCCAGCCGGCAAGG - Intronic
1066094143 10:32056454-32056476 GCGCAGTGGGCCAGGCGGCCCGG + Intergenic
1075324329 10:121518697-121518719 GGACAGTGAGCCAGGCAGACTGG + Exonic
1076791428 10:132778953-132778975 GAACAGTAAGGAACCCGGCCCGG - Intronic
1077009070 11:372122-372144 GACCAGTGAGACCGACGGCCGGG + Exonic
1077170953 11:1165487-1165509 GACGAGGGAGCCTGCCGGCCTGG - Intronic
1077840581 11:5970469-5970491 GGACAGGGAGCCAGCAGGACTGG + Intergenic
1077848204 11:6048417-6048439 GGACAATGAGACAGCAGGCCTGG + Intergenic
1080036782 11:27719515-27719537 GCTCAGTGAGGCATCCGGCCCGG + Intronic
1083673119 11:64310916-64310938 GAACAGTGAGCCAGCCGGCCAGG + Intronic
1084112439 11:67022990-67023012 GGACTCAGAGCCAGCCGGCCTGG - Intronic
1084651981 11:70494855-70494877 GCCCAGTGAGCCTGCAGGCCTGG - Intronic
1084900638 11:72307591-72307613 GGGCAGTGAGCCAGGAGGCCTGG - Intronic
1085311897 11:75521856-75521878 GAGCAATGAGCCAGAAGGCCGGG + Intronic
1085709673 11:78817743-78817765 GAACAGAAAGGCAGACGGCCTGG + Intronic
1090806711 11:130207258-130207280 GAATTGTGAGCCAGCGGGCACGG + Intronic
1092140515 12:6180398-6180420 GTCCAGTGAGTCAGCCGGGCTGG - Intergenic
1093779521 12:23119301-23119323 CAAGAGTGAGCCACCCTGCCTGG + Intergenic
1095845257 12:46737372-46737394 GAACTGTGAGGCAGCAAGCCTGG + Intergenic
1096820721 12:54231930-54231952 GTACAGTGACCCAGCTGTCCTGG + Exonic
1101102587 12:101408521-101408543 GAAAAGTGAACCTTCCGGCCGGG + Intergenic
1104175374 12:126326382-126326404 GAACTGTGAGGCAGCAAGCCTGG - Intergenic
1104898680 12:132176326-132176348 GAACAGGGGACCAGCCGGGCCGG - Intergenic
1106025091 13:25948789-25948811 GATCAGGGAGCCAGCATGCCTGG - Intronic
1106617081 13:31339935-31339957 GAGCAGCGAGCCAGCCCTCCTGG - Intergenic
1112091727 13:96090574-96090596 GAGCAGGGAGCGGGCCGGCCCGG + Intergenic
1113939297 13:114010269-114010291 GAACAGGGAACCAGGAGGCCTGG + Intronic
1114655964 14:24315843-24315865 GAGCAGTGAGCAATACGGCCAGG - Exonic
1115057940 14:29153651-29153673 AAAAAGTAAGCCAACCGGCCAGG + Intergenic
1116815793 14:49582334-49582356 GAAGAGTGAGAAAGCTGGCCAGG - Intronic
1116849011 14:49890777-49890799 GAAGCGTGAGCCACCAGGCCTGG - Intergenic
1118855396 14:69617829-69617851 GAACAGAGAGCCAGCCAGCAAGG + Intronic
1122248854 14:100424170-100424192 GAACACTCACCCAGCCAGCCTGG - Intronic
1128658069 15:69477123-69477145 GCACCGGGAGCCAGCCTGCCTGG + Intergenic
1129243837 15:74268046-74268068 GAACAGACAGCCAGGGGGCCTGG - Intronic
1129504757 15:76072013-76072035 GAAGAGAGAGCCAGCAGGGCCGG + Intronic
1130110615 15:80960864-80960886 CAACAGGGAGCCAGAGGGCCAGG - Intronic
1132229625 15:100171741-100171763 GAGCACTGAGCCAGGCTGCCGGG - Intronic
1132783579 16:1642050-1642072 GAGCAGTCAGCCAGGCTGCCGGG - Intronic
1133038901 16:3049555-3049577 GGCCAGAGACCCAGCCGGCCTGG + Intronic
1133070527 16:3243810-3243832 GCACAGGGATCCAGCAGGCCAGG + Intronic
1133366269 16:5212770-5212792 GAAAAGTGGCTCAGCCGGCCAGG + Intergenic
1134285952 16:12862379-12862401 GAGCAGTGAGCGAGCCGGAGCGG - Intergenic
1134819350 16:17233696-17233718 GAAGAGTGAGCAAGCAAGCCTGG + Intronic
1135969151 16:27059709-27059731 TAGCAGTGTGCCAGCAGGCCTGG - Intergenic
1137478754 16:48833579-48833601 AACCAGTGAGCCAGGTGGCCAGG - Intergenic
1137821162 16:51447469-51447491 CAAGCATGAGCCAGCCGGCCTGG - Intergenic
1137822262 16:51457521-51457543 GAACAGTTAGCCAGCCGTGGTGG - Intergenic
1138437719 16:57014794-57014816 AATCAGGGAGCCAGCAGGCCTGG + Intronic
1142150263 16:88509568-88509590 GAGCTGTGAGCCAGCCTGCCAGG + Intronic
1142481627 17:222361-222383 GAACTGGAAGCCAGCAGGCCTGG + Intronic
1143908333 17:10227352-10227374 GAGCAGTGAGCAAGCCAGCGAGG - Intergenic
1143950454 17:10628639-10628661 GAAGAGTGAGCCAGCCCTTCTGG - Exonic
1144857261 17:18276312-18276334 GGACAGTCAGTCAGCCAGCCTGG + Intronic
1145966718 17:28924130-28924152 GAAAGGAGAGCCAGCAGGCCTGG - Exonic
1146431266 17:32797262-32797284 GAAAAGTGATGCAGCAGGCCAGG - Intronic
1146729590 17:35182382-35182404 TGAAAGTGAGCCACCCGGCCGGG - Intronic
1148693958 17:49548189-49548211 GAACAGTGAGGCAGTGGGGCGGG - Intergenic
1148711812 17:49687417-49687439 TAACGGAGAGCCAGCCAGCCAGG - Intergenic
1153880517 18:9418187-9418209 GAGCAGTGAGCAGGCAGGCCTGG + Intergenic
1153893071 18:9536006-9536028 GTACAGCGAGAGAGCCGGCCTGG - Exonic
1155095150 18:22548313-22548335 GAACAGGGAGCCAGCAGGCCTGG + Intergenic
1157633365 18:49123588-49123610 GAACAGTGAGCCTGCTGAGCTGG - Intronic
1162390076 19:10384450-10384472 CAAAAGTTAGCCAGCCGGCCAGG - Intergenic
1163042053 19:14609893-14609915 GCACAGTGAGCCACCGTGCCTGG - Intronic
1163241343 19:16065751-16065773 GAACAGTGAGGCAGCTGGGAGGG + Intergenic
1165077328 19:33287111-33287133 CAACAGGAAGCCAGACGGCCTGG + Intergenic
1168026383 19:53646775-53646797 TTACAGTGAGCCAGCGGGCCGGG - Intergenic
1168523825 19:57073039-57073061 GAAAAGTGAGTATGCCGGCCGGG - Intergenic
925878503 2:8331741-8331763 GCACAGTGAGCCTGCGGGTCAGG + Intergenic
926002883 2:9348175-9348197 TCACAGTGAGCCATCCAGCCTGG - Intronic
927633326 2:24793234-24793256 TACCAGTGCGCCCGCCGGCCAGG + Exonic
928457792 2:31439240-31439262 CAACAGTGAGCCTTCCGGCCGGG + Intergenic
930646097 2:53909680-53909702 CAACCGTGAGCCACCCTGCCCGG - Intronic
932633904 2:73371230-73371252 GAACAGTGAGGAAGCCAGCATGG + Intergenic
934991163 2:98922541-98922563 GCCCAGTGGGCCAGCTGGCCTGG + Intronic
936536590 2:113316555-113316577 GAACAGTGAGCCAGGCAGAATGG + Intergenic
938124566 2:128662658-128662680 GAACAAAGAGCCAGCTGGCCAGG + Intergenic
939422196 2:141986452-141986474 GAACAGTTAGCCAGTCTGCCAGG + Intronic
947490930 2:230593887-230593909 GAGCAGTGAGGCAGCGGCCCCGG - Intergenic
1169033845 20:2433692-2433714 CAACAGTGGACCAGCCGGCCAGG + Intergenic
1172171732 20:32939576-32939598 GAAAAGAAAGCCAGCCCGCCAGG - Intronic
1172609168 20:36236618-36236640 AAACAGAGAACCAGCCGCCCCGG - Exonic
1173074896 20:39808266-39808288 GCACAGTTAGCCAGAAGGCCTGG + Intergenic
1173349597 20:42232864-42232886 GAAGAGGTAGCCAGCCTGCCTGG - Intronic
1174055615 20:47796215-47796237 GAGCAGGGAGCCAGCCTCCCCGG + Intergenic
1175053811 20:56179270-56179292 GAAGTGTGAGCCAGCTGGCAGGG - Intergenic
1175877664 20:62238185-62238207 AAACAGTGAGTCAGGTGGCCCGG - Intronic
1180697851 22:17764710-17764732 GTACAGTGACCCAGCTGTCCTGG + Intronic
1181627232 22:24130256-24130278 GAACACTGAGCCAGCCATCATGG - Intronic
1182282040 22:29223517-29223539 GAACATTGAGCCTCCCTGCCAGG + Intronic
1183316645 22:37140818-37140840 GAACTGGGAGCCCGCAGGCCTGG + Intronic
1183947578 22:41335425-41335447 GAACAGTGAGCCTGGCAGGCTGG + Intronic
1184016192 22:41787488-41787510 GGACACTTAGCCAGCTGGCCAGG + Intronic
1184077803 22:42194445-42194467 GAACATTGTGCAAGGCGGCCGGG - Intronic
1184562204 22:45269603-45269625 GGACAGTGAGTCCCCCGGCCGGG + Intergenic
1184693050 22:46126041-46126063 GCTGAATGAGCCAGCCGGCCCGG - Intergenic
1185402814 22:50627375-50627397 GAACCGGGAGCCGGCCGGTCAGG + Exonic
950252813 3:11480844-11480866 GAAGAGAGGCCCAGCCGGCCAGG - Intronic
952130603 3:30357163-30357185 GAACTCTAAGCCAGCCAGCCAGG + Intergenic
953779228 3:45851500-45851522 GAAGAGTGAGCCACCGTGCCTGG + Intronic
954301980 3:49705028-49705050 GAGAACTGAGCCAGCCGGGCCGG - Exonic
961280582 3:125763403-125763425 GAAAAGTGGCTCAGCCGGCCAGG + Intergenic
963723325 3:148889592-148889614 CAAAAGTGAGCCACCAGGCCTGG - Intronic
966167431 3:177036214-177036236 CAACAGTGAACCACCAGGCCTGG + Intronic
966773983 3:183528127-183528149 GAACAGAGAGCCACCAGCCCAGG - Intronic
968011413 3:195281126-195281148 GAGGCGTGAGCCACCCGGCCGGG - Intronic
968073272 3:195801456-195801478 GAGCAGTGAGCCATCCGGGCAGG - Intronic
968634368 4:1670376-1670398 GCACAGTGGGCCACCCAGCCTGG + Intronic
969154440 4:5197876-5197898 CAATAGTGAGCCATCCTGCCTGG + Intronic
972765656 4:42151121-42151143 GAACTGAGAGCCAGCCAGCATGG + Intronic
973699081 4:53519105-53519127 GGGCAGTGAGACAGCCAGCCTGG - Intronic
975130012 4:70823590-70823612 CAAGAGTGAGCCACCCCGCCTGG - Intronic
975882654 4:78929075-78929097 GAGCAGTGGGCCAGCGAGCCAGG - Intronic
978503597 4:109433998-109434020 GAACGGTGAGGCGGGCGGCCCGG + Exonic
978606529 4:110486395-110486417 GAACACTGAACCAGACGGACTGG - Intronic
979253210 4:118586619-118586641 GAGCTGTGAGCCAGCTGGCGTGG + Intergenic
979694917 4:123602411-123602433 GAAGAGTGAGCCACCATGCCCGG - Intergenic
984661449 4:182379738-182379760 GAACATGGGGCCAGACGGCCTGG - Intronic
987074146 5:14365022-14365044 GAACAGCCAGCCAGCTGTCCTGG - Intronic
989543890 5:42649919-42649941 GAATGGTGAGCCAGCCACCCAGG + Intronic
989584606 5:43064893-43064915 AGACAGTGAGACAGCCAGCCCGG + Intergenic
992004882 5:72467599-72467621 TCACAGTGAGCCAGCATGCCAGG + Intronic
992423605 5:76632423-76632445 GTACAATGAGCCAGCCTGCAAGG + Intronic
994514381 5:100752278-100752300 GCACAGTGAGCCACCGCGCCCGG + Intergenic
996521948 5:124437161-124437183 GAACAGTGAGCTGGCCAGGCTGG - Intergenic
998311589 5:141137474-141137496 AGACAGTGAGCGAGTCGGCCTGG - Exonic
998318999 5:141210950-141210972 AGACAGTGAGCGAGTCGGCCTGG - Exonic
999433282 5:151542354-151542376 GAACAGTGAGCCTGGCGAACTGG - Exonic
1000624975 5:163528406-163528428 CAAGAGTGAGCCACCCCGCCCGG + Intergenic
1001188281 5:169599787-169599809 GAACAGTGAGCCAGGCGTGGTGG + Intronic
1005668224 6:28079245-28079267 GAAAAGTGAGCCAACACGCCCGG + Intergenic
1007416755 6:41695598-41695620 GGGCTGTGAGCCAGCCTGCCTGG - Intronic
1010672599 6:78704088-78704110 AAACAGAGAGCCAGCCAGACAGG - Intergenic
1012868547 6:104646132-104646154 GAACAGTCAGGCAGGTGGCCAGG + Intergenic
1017744926 6:157437413-157437435 GAACAGGGCGACAGCCTGCCCGG - Intronic
1021196201 7:17676996-17677018 GAACTGTGAGCCAGTCTGCCTGG + Intergenic
1023125298 7:36949149-36949171 GAAGAGTGAGTGAGCAGGCCAGG - Intronic
1023966934 7:44967647-44967669 GAAGAGTGTGCCAGCCGTCAGGG + Exonic
1026510169 7:71020922-71020944 CAGCCGTGAGCCACCCGGCCTGG - Intergenic
1026926815 7:74199987-74200009 GAACTGTGAGCCACCATGCCCGG - Intronic
1029378294 7:100195760-100195782 GCACAGTGAGACAGCAGGCTGGG - Intronic
1032022742 7:128418925-128418947 GAGCAGTGAGCAGGCCGTCCTGG + Intergenic
1035886846 8:3300677-3300699 GAAGCGTGAGCCACCAGGCCTGG - Intronic
1036241939 8:7088860-7088882 GAAAAGTGGCTCAGCCGGCCAGG + Intergenic
1036259900 8:7231239-7231261 GAAAAGTGGCTCAGCCGGCCAGG - Intergenic
1036306715 8:7608283-7608305 GAAAAGTGGCTCAGCCGGCCAGG + Intergenic
1036311943 8:7689808-7689830 GAAAAGTGGCTCAGCCGGCCAGG - Intergenic
1036357565 8:8056271-8056293 GAAAAGTGGCTCAGCCGGCCAGG + Intergenic
1036900937 8:12668659-12668681 GAAAAGTGGCTCAGCCGGCCAGG - Intergenic
1037689562 8:21170730-21170752 GAACAGGGAACCAGCCTGGCAGG + Intergenic
1038566317 8:28622657-28622679 GGACCGGGAGCCGGCCGGCCGGG + Intronic
1039143919 8:34423790-34423812 GAACAGCCAGCCAGACAGCCAGG - Intergenic
1039472393 8:37821588-37821610 GACCAGGGACCAAGCCGGCCAGG + Intronic
1039828040 8:41191516-41191538 GAACACTGAGCCAGCAGCCAGGG - Intergenic
1042676779 8:71330070-71330092 GAACAGTAAGCAAGGCGGGCAGG + Intronic
1047092265 8:121587272-121587294 GAACAGAGAGCCAAACGGGCTGG - Intergenic
1048850038 8:138636275-138636297 GAGCAGTGGTCCAGCAGGCCTGG + Intronic
1049245075 8:141557993-141558015 GAGCCGTGAGCCAGCCGTGCAGG - Intergenic
1056006464 9:82277141-82277163 AAACAGGAAGCCAGCCAGCCAGG + Intergenic
1059433354 9:114262784-114262806 GAACAGGGAGCCACCGGGCAAGG - Intronic
1196314316 X:114204768-114204790 CAAGAGTGAGCCAACAGGCCAGG - Intergenic
1196691115 X:118559620-118559642 CAAAAGTGAGCCACCCTGCCTGG - Intronic
1199255164 X:145711055-145711077 GATCAGTGAAACAGCCTGCCTGG + Intergenic
1199568205 X:149239934-149239956 GAGCAGTGACCCAGCCAGCTTGG - Intergenic
1200154237 X:153966904-153966926 GATCAGTGAGCCGGTGGGCCAGG + Intronic