ID: 1083673120

View in Genome Browser
Species Human (GRCh38)
Location 11:64310917-64310939
Sequence AACAGTGAGCCAGCCGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083673111_1083673120 24 Left 1083673111 11:64310870-64310892 CCAAAATCCACCAATCTTAAACT 0: 1
1: 0
2: 0
3: 23
4: 286
Right 1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 184
1083673114_1083673120 -6 Left 1083673114 11:64310900-64310922 CCCTTCCCACTCTGAAGAACAGT 0: 1
1: 0
2: 3
3: 22
4: 254
Right 1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 184
1083673112_1083673120 17 Left 1083673112 11:64310877-64310899 CCACCAATCTTAAACTTTGTGCA 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 184
1083673115_1083673120 -7 Left 1083673115 11:64310901-64310923 CCTTCCCACTCTGAAGAACAGTG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 184
1083673113_1083673120 14 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083673120 Original CRISPR AACAGTGAGCCAGCCGGCCA GGG Intronic
900986186 1:6073935-6073957 AAAGGTGAGCCAGGTGGCCATGG + Intronic
902126137 1:14213245-14213267 AACAGTGAGCCAGCAACCAAGGG - Intergenic
902440984 1:16429762-16429784 AAAAGTCAGCCAGCCGGGCGCGG - Intronic
902511857 1:16970892-16970914 TCCAGTGACCCAGCGGGCCATGG + Intronic
903558330 1:24209543-24209565 AAAAATTAGCCAGCCGGGCATGG + Intergenic
904804762 1:33122977-33122999 GTCAGAGAGCCAGCTGGCCAAGG - Intergenic
905078837 1:35298745-35298767 AACATTGTGCCAGCTGGCAAAGG + Intronic
905294397 1:36945057-36945079 AACAGTGTGGCCGACGGCCAGGG - Intronic
905300151 1:36981391-36981413 GGCAGTGAGCCAGCCAGCCAAGG + Intronic
905972849 1:42154410-42154432 AACAGACAGGCAGCCGGTCATGG + Intronic
906518478 1:46453403-46453425 AACAGGGAGCCTGCCTGCCCTGG + Intergenic
908360413 1:63363691-63363713 AGCCGTGAGCCAGCGGGCCTGGG + Intergenic
910777225 1:90889124-90889146 AAAAGTGAACCAGCCGGGCGTGG - Intergenic
911080319 1:93922573-93922595 AACATTAAGCCAGCTGGTCACGG - Intergenic
911507681 1:98773882-98773904 AATATTGACCCAGCCGGGCAAGG - Intergenic
911605574 1:99900841-99900863 ACCAGTGTGCCAGCAGGCAAAGG - Exonic
912320092 1:108705109-108705131 AACATTATGCCAGCCGGCAATGG - Intergenic
915210919 1:154308689-154308711 AAGAGTGAGCCAACTGGGCATGG + Intergenic
915343680 1:155189170-155189192 AACAGAGAGCAGGCCGGCCCCGG - Intronic
917119831 1:171635836-171635858 AAGGGAGAGCCAGCCAGCCAGGG - Exonic
917796693 1:178538001-178538023 ATCAATCGGCCAGCCGGCCAAGG + Intronic
919087493 1:192937846-192937868 AAATGTAAGCCAGCCGGGCATGG + Intergenic
920641031 1:207752145-207752167 AACCGAGAGCCAGCCGAGCAGGG - Exonic
920957491 1:210632879-210632901 CACAGGGACCCAGGCGGCCATGG + Intronic
921339239 1:214117982-214118004 AACATTGAACCAGCTGGCAAAGG - Intergenic
921414755 1:214872561-214872583 AACATTGAGCCAGCTAGCAAAGG + Intergenic
921798237 1:219372619-219372641 AGGTGTGAGCCAGCAGGCCAGGG - Intergenic
922431155 1:225555288-225555310 AACAGTAAATCAGCCGGGCACGG + Intronic
924141302 1:241026652-241026674 AACAGTGAGCCAGGCAGGAAGGG + Intronic
924264076 1:242263109-242263131 AGAAGTGAGACAGCTGGCCAAGG - Intronic
1064247194 10:13678354-13678376 ATCACTGAGCCAGCCTGCCTTGG + Intronic
1065358638 10:24868081-24868103 ACCATTAAGCCAGCCAGCCACGG - Intronic
1067857471 10:49807605-49807627 AATATTGAGCCAGCTGGGCACGG + Intergenic
1069508210 10:69020597-69020619 TGCAGTGAGCCGGCCGGGCACGG + Intergenic
1071056829 10:81521084-81521106 AAAAGTAACCCAGCCGGGCACGG + Intergenic
1072175529 10:92917116-92917138 AAAAATTAGCCAGCCGGGCATGG - Intronic
1072743280 10:97923041-97923063 ACCAGTGAGGAAGCCAGCCAAGG - Intronic
1075767640 10:124906889-124906911 AAGACTGTGCCAGCCGGGCACGG + Intergenic
1077423546 11:2463937-2463959 GACAGTGAGCCTGCTGGGCACGG - Intronic
1079446491 11:20561532-20561554 AACAGGGAGTCAGCTGGCCAAGG - Intergenic
1081235742 11:40645432-40645454 AACAGGGAGCCAGGTGGCAAAGG - Intronic
1083673120 11:64310917-64310939 AACAGTGAGCCAGCCGGCCAGGG + Intronic
1083774358 11:64886993-64887015 AACAGAAAGACAGCCGGGCACGG + Intronic
1085325384 11:75602404-75602426 CACAGTGAGCCAGCCCCCTATGG + Intronic
1089381592 11:118036658-118036680 ATCAGGGAGGCAGCTGGCCATGG + Intergenic
1091545825 12:1500729-1500751 AAGCAGGAGCCAGCCGGCCAAGG - Intergenic
1091861715 12:3791443-3791465 AACATGGAGCCAGCTGGCAAAGG - Intronic
1092119676 12:6035080-6035102 CAAAGTGAGCCAGGCAGCCAGGG + Intronic
1093479075 12:19585729-19585751 AACAGGAAGCCAGCTGGCAAAGG + Intronic
1096757011 12:53808222-53808244 AACTATGAGACAGCCAGCCAGGG - Intergenic
1099001181 12:77179688-77179710 GACTGTGAGCCAGCTGGCCCAGG + Intergenic
1100264528 12:92962675-92962697 AAAAGTAAGTCAGCCGGGCACGG - Intergenic
1101914296 12:108884440-108884462 TACTGTGAGCCAGCTGGCCCCGG - Intronic
1102152554 12:110698835-110698857 AACACACAGCCAGCCGGGCACGG + Intronic
1102286843 12:111664652-111664674 AGCAGTGAGCAAGCCAGGCATGG + Intronic
1103401062 12:120642876-120642898 AACAGTGAACCAGATAGCCAGGG + Intronic
1104049574 12:125186528-125186550 AACTGCGGGGCAGCCGGCCAGGG + Intergenic
1105621933 13:22076476-22076498 AGCAGCGAGCCAGCTGGGCATGG + Intergenic
1107758172 13:43648326-43648348 AACAGTGAACCAGAGAGCCATGG + Intronic
1114073270 14:19132117-19132139 AACGTTGAGCCAGGCGGGCATGG - Intergenic
1114682996 14:24502640-24502662 AACAGTGGACCAGCAGGCAAAGG + Intronic
1115952345 14:38735325-38735347 AAAAGTAAGCCAGCTGGCAATGG + Intergenic
1116815792 14:49582333-49582355 AAGAGTGAGAAAGCTGGCCAGGG - Intronic
1117773185 14:59155311-59155333 AAAATTGTGCCAGCCGGGCACGG + Intergenic
1119172887 14:72547876-72547898 AACAGTAAGCCAGACCGCCACGG - Intronic
1121280207 14:92692422-92692444 AGGAGGGAGCCAGCCGGCCATGG - Intergenic
1121803497 14:96795074-96795096 AACAGTGAGCCATCAGATCAAGG + Intergenic
1122857280 14:104565915-104565937 AGTTGTGAGCCAGCCAGCCAGGG - Intronic
1123569782 15:21592134-21592156 AACAGGGACCCAGCCAGGCAGGG - Intergenic
1123605892 15:22027453-22027475 AACAGGGACCCAGCCAGGCAGGG - Intergenic
1126023711 15:44426623-44426645 AACAGTGAGCCAGGCAGACACGG - Intergenic
1126143730 15:45457369-45457391 AACAGTGAAACAGCCGTCCCAGG + Intergenic
1127102397 15:55580666-55580688 AACTGTGAGCCTGACTGCCAAGG - Intronic
1129689813 15:77706758-77706780 TACAGTGAGCAAGGCAGCCATGG - Intronic
1130110614 15:80960863-80960885 AACAGGGAGCCAGAGGGCCAGGG - Intronic
1131250952 15:90829697-90829719 AAGAGTGAGCCAACAGGCCAAGG + Intergenic
1131971811 15:97901044-97901066 CACAGTGAGCCTGCAGGCAAGGG - Intergenic
1202978130 15_KI270727v1_random:319225-319247 AACAGGGACCCAGCCAGGCAGGG - Intergenic
1132815062 16:1821914-1821936 AACAAGCAGCCAGCCGGGCACGG - Intronic
1133070528 16:3243811-3243833 CACAGGGATCCAGCAGGCCAGGG + Intronic
1135421339 16:22307596-22307618 AAAAGGGAGCCAGGCAGCCATGG - Intronic
1136034456 16:27528549-27528571 AAGTGAGAGCCAGCCAGCCAAGG + Intronic
1137478753 16:48833578-48833600 ACCAGTGAGCCAGGTGGCCAGGG - Intergenic
1141748439 16:85942066-85942088 AACAGCCAGCCAGGTGGCCAAGG - Intergenic
1142139566 16:88466820-88466842 AACTGAGAGGCTGCCGGCCAGGG - Intronic
1142150264 16:88509569-88509591 AGCTGTGAGCCAGCCTGCCAGGG + Intronic
1142679522 17:1538305-1538327 AACAGTGAGCAAGCCAGACCTGG + Intronic
1144995713 17:19266894-19266916 AACACTGAACCTGCCGGGCACGG + Intronic
1146015641 17:29231288-29231310 AACAATTAGCCAGCCAGCCATGG + Intergenic
1148620811 17:49033302-49033324 AAAAATTAGCCAGCCGGGCATGG - Intronic
1149650201 17:58271827-58271849 AACTGTGGGCCAGCTGGGCACGG - Exonic
1151372407 17:73656506-73656528 AGCAGAGAGCTAGCAGGCCAAGG - Intergenic
1152407242 17:80104756-80104778 AGCAGGGAGCCAGCAGACCAGGG + Intergenic
1152584968 17:81184914-81184936 CACAGTGAGCCCACCGGACAGGG + Intergenic
1152685598 17:81692336-81692358 AACAGGGGGCCAGGTGGCCACGG - Intronic
1153909484 18:9694512-9694534 AAGACTGAGTCAGCCGGGCATGG + Intergenic
1155809748 18:30217122-30217144 ATCAGTCAGCCAGCCTGGCATGG + Intergenic
1155954967 18:31949119-31949141 AAAAATCAGCCAGCCGGGCATGG + Intronic
1157113933 18:44845672-44845694 AGCAGTGAGCCAGCTGCCCATGG - Intronic
1157545751 18:48545348-48545370 GACTGGGAGCCAGGCGGCCATGG + Intronic
1160686949 19:441325-441347 AACAGTGGGGCAGACGTCCAGGG + Intronic
1164521510 19:28983490-28983512 AACACCAAGCCAGCCAGCCAAGG + Intergenic
1165077329 19:33287112-33287134 AACAGGAAGCCAGACGGCCTGGG + Intergenic
1167752025 19:51387250-51387272 ATCGGTGAGCCCCCCGGCCAGGG - Exonic
925589837 2:5498541-5498563 AACAGTGGCCCGGCCGGTCATGG - Intergenic
925878504 2:8331742-8331764 CACAGTGAGCCTGCGGGTCAGGG + Intergenic
926002882 2:9348174-9348196 CACAGTGAGCCATCCAGCCTGGG - Intronic
927139550 2:20120324-20120346 AAAAGAAAGCCAGCCGGGCATGG + Intergenic
927441121 2:23118595-23118617 GAAAGGGAGCCAGCCGGCTAAGG - Intergenic
928203916 2:29270707-29270729 AGCAGTGAGCTGGCCAGCCAAGG - Intronic
928265735 2:29810129-29810151 GACAGAGAGTCAGCCGGACATGG + Intronic
931375240 2:61701254-61701276 AACAATTAGCCAGCTGGGCATGG - Intergenic
932744960 2:74326327-74326349 AACAGTGAGCTAGTTGGGCAGGG - Intronic
934968262 2:98742303-98742325 AACAGAAAGGCAGCCGGGCACGG + Intergenic
936399212 2:112153235-112153257 AAATGTGAGCCTGCTGGCCAAGG - Intronic
938380602 2:130834386-130834408 AACAGGCAGCCAGCCGGCTACGG - Intergenic
940267303 2:151852401-151852423 AACAGTGAGCCAGAGGGGCACGG + Intronic
943374769 2:187062772-187062794 TACAGGGAGCCAGCTGGCAAAGG + Intergenic
944233610 2:197421686-197421708 AACAGAGACCCAGCTGGGCAAGG + Intronic
944760292 2:202807627-202807649 ACCAGCCAGCCAGCCAGCCAAGG + Intronic
945423113 2:209663387-209663409 CACAGTGAGCCGGCAGGACACGG - Intronic
946900074 2:224363834-224363856 ATCAGTGAGTCAGACAGCCAGGG + Intergenic
947789233 2:232853561-232853583 AAGAGGAAGCCAGCCGGGCACGG - Intronic
948623681 2:239252952-239252974 AACGGAGAGCCCGCTGGCCACGG + Intronic
1169216751 20:3798589-3798611 GTCAGTGAGCCCCCCGGCCATGG - Intronic
1175799165 20:61791457-61791479 AACAGTGATTCACCCGGTCATGG + Intronic
1175877663 20:62238184-62238206 AACAGTGAGTCAGGTGGCCCGGG - Intronic
1180225423 21:46389145-46389167 CTCAGTGAGCAAGCCGGCCGCGG - Intronic
1181067851 22:20315133-20315155 GAGGGTGAGCCAGCCAGCCATGG - Intronic
1181168069 22:20993850-20993872 AACAGAGACCCAGCCAGCCAAGG - Intronic
1181801449 22:25350516-25350538 GACAGTGACCCAGCCAGCCCCGG - Intergenic
1183744485 22:39685137-39685159 AACAGTGAGCCCGGCAGGCAGGG - Intronic
1184467256 22:44676233-44676255 AAAAATGAGTCAGCCGGGCATGG + Intronic
1184583149 22:45430491-45430513 AGCTGTGGGGCAGCCGGCCATGG + Intronic
1184617360 22:45647026-45647048 AACCGTTAGCCGGCCGGGCACGG - Intergenic
1184725985 22:46346740-46346762 AACAGTGTCCCTGCCGGCCATGG + Intronic
950727763 3:14928452-14928474 TACAGTGAACTAGCCGGGCATGG + Intronic
955078721 3:55638088-55638110 GACAGTGAGCCCGCTGGCCCAGG + Intronic
956010931 3:64830865-64830887 GTCAGTGACCCAGCCAGCCAAGG - Intergenic
960897525 3:122521099-122521121 ACCAGTGAGCAAACCGGGCACGG + Intergenic
963016872 3:140832509-140832531 AAGAATGAACCAGCCGGGCATGG - Intergenic
963848142 3:150180986-150181008 AAAAGTGGGGCAGCAGGCCACGG + Intergenic
964096179 3:152934411-152934433 AACAGAGAAACAGCCGGGCACGG + Intergenic
968762201 4:2448599-2448621 AGAAGTGAGCAAGTCGGCCATGG + Intronic
975875375 4:78829932-78829954 TGCAGTGAGCCAGGAGGCCAAGG - Intronic
975882653 4:78929074-78929096 AGCAGTGGGCCAGCGAGCCAGGG - Intronic
979266549 4:118709989-118710011 AACTGTGAGCCAGCCTGAAATGG - Exonic
980382830 4:132046659-132046681 AACAATGAGCCAGCCAGGCAAGG + Intergenic
982541115 4:156672858-156672880 AACAGGGAGTCAGCGGGCAAAGG + Intergenic
982851461 4:160321438-160321460 AACAGAAGCCCAGCCGGCCAAGG + Intergenic
984933169 4:184866621-184866643 AAAAGGGAGCCAGCAGGCAAAGG - Intergenic
987091083 5:14508179-14508201 AGGAGTGAGCCAGAAGGCCAAGG + Exonic
987336963 5:16905537-16905559 ACCAGCCAGCCAGCCAGCCAGGG + Intronic
988993503 5:36693217-36693239 GACGGAGAGCCAGCCGGCCCTGG + Intergenic
989543891 5:42649920-42649942 AATGGTGAGCCAGCCACCCAGGG + Intronic
989584607 5:43064894-43064916 GACAGTGAGACAGCCAGCCCGGG + Intergenic
989617382 5:43350318-43350340 AACATTGTGCCAGCTGGCAAAGG + Intergenic
992004883 5:72467600-72467622 CACAGTGAGCCAGCATGCCAGGG + Intronic
992423606 5:76632424-76632446 TACAATGAGCCAGCCTGCAAGGG + Intronic
996531997 5:124536020-124536042 AAAAATTAGCCAGCCGGGCATGG + Intergenic
998311588 5:141137473-141137495 GACAGTGAGCGAGTCGGCCTGGG - Exonic
998318998 5:141210949-141210971 GACAGTGAGCGAGTCGGCCTGGG - Exonic
999370855 5:151054388-151054410 AACAGAGAACCAGCTGGGCATGG + Intronic
999382305 5:151129990-151130012 AACAGTGAGAGGGCCGGGCATGG - Intronic
1000324643 5:160163026-160163048 AAGAGGGAGCCAGCCGGGCATGG - Intergenic
1003320212 6:5044419-5044441 AACAGTGTGTCAGCCGGGCATGG - Intergenic
1004458090 6:15810198-15810220 AACAGGGAGGCAGCTGGCAAAGG + Intergenic
1005746436 6:28842540-28842562 AGAAATGAGCCAGCCGGGCATGG + Intergenic
1006258700 6:32851212-32851234 AACAATGAGCCAGGATGCCAGGG + Intronic
1007047862 6:38796037-38796059 AAAAGGGACCCAGCTGGCCAAGG - Intronic
1007650680 6:43418841-43418863 CCCAGTCAGCCAGGCGGCCATGG + Intergenic
1009338321 6:62522612-62522634 AACATTGTGCCAACTGGCCAAGG - Intergenic
1010892696 6:81334026-81334048 AAGAGTGAGGCAACCAGCCACGG + Intergenic
1021196202 7:17676997-17677019 AACTGTGAGCCAGTCTGCCTGGG + Intergenic
1022276600 7:28861448-28861470 GAAAGTGACCCAGCCTGCCATGG + Intergenic
1022882421 7:34601933-34601955 AGCAGAGAGCAGGCCGGCCATGG + Intergenic
1023292112 7:38679127-38679149 AACATTGTGCCAGCCAGCAAAGG + Intergenic
1024078008 7:45832963-45832985 GACAGAGAGGCAGCTGGCCAGGG - Intergenic
1024760924 7:52595135-52595157 AAAATTGACCCAGCCGGGCATGG - Intergenic
1026039847 7:66859017-66859039 AACAGTAAGACGGCCGGGCATGG - Intergenic
1026452929 7:70545194-70545216 AAAAGAGAGCCACCCAGCCAGGG + Intronic
1029682698 7:102122938-102122960 AATAGAGAGGCAGCCGGGCACGG + Intronic
1031128813 7:117807045-117807067 AGAAATGAGCCAGCCGGGCATGG - Intronic
1031700398 7:124918085-124918107 AACCATGAGCCAGCAGGGCATGG + Intronic
1032831749 7:135634215-135634237 ATCTGTGAGCCAGCTGGGCATGG - Intronic
1033116676 7:138631857-138631879 GAGAGTGAGCCTGCCGGGCATGG - Intronic
1033356611 7:140605751-140605773 GACAGTGTGCAGGCCGGCCAAGG - Intronic
1037783939 8:21891266-21891288 AAGAGTGAGCCAGGGGACCATGG + Intergenic
1039472394 8:37821589-37821611 ACCAGGGACCAAGCCGGCCAGGG + Intronic
1041774343 8:61507948-61507970 AACAGTGAGCCAAGCTTCCAGGG - Intronic
1042765490 8:72316663-72316685 AACAGGAAGCCAGCTGGCAAAGG - Intergenic
1043560326 8:81486026-81486048 AACAGTGAGCCAGCCAGGGCAGG + Intergenic
1045017592 8:98012469-98012491 TACAGTGAGCCAGCCAGAGATGG + Intronic
1045169233 8:99645331-99645353 AGCATTGAGCCAGCAGGCCTAGG + Intronic
1046761748 8:118028637-118028659 AAAAGTAAGCCAGCCGGGCGTGG + Intronic
1047757050 8:127926797-127926819 AAAAGAGAGCCAGCAGGCCAAGG - Intergenic
1050704819 9:8385232-8385254 AAGAGTGAGCCAGCCAGGCACGG + Intronic
1056848911 9:90064411-90064433 ACCAGTGAGCCAGTGGGTCAAGG - Intergenic
1058669134 9:107346016-107346038 ATCAGTGGGCAAGCCGGGCACGG + Intergenic
1060237108 9:121872216-121872238 AGAAGTGTGCCAGCCAGCCACGG - Intronic
1061312360 9:129772212-129772234 AACAAAAAGCTAGCCGGCCATGG + Intergenic
1185540774 X:901584-901606 AAGTGGGAGCCAGCCGGGCATGG - Intergenic
1186762253 X:12735156-12735178 AACAGCAAACCAGCCGGTCATGG - Intergenic
1197143555 X:123143965-123143987 AACAGTGAGGCAGGGGGTCAAGG + Intergenic
1197839247 X:130728009-130728031 AACATTGTGCCAGCTGGCAAAGG - Intronic
1199808056 X:151321036-151321058 AACAGTGAGGAAGCCGGGCGCGG - Intergenic
1200094827 X:153652642-153652664 AACAGTGATTCAGCCGGGCACGG + Intergenic