ID: 1083673121

View in Genome Browser
Species Human (GRCh38)
Location 11:64310922-64310944
Sequence TGAGCCAGCCGGCCAGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 253}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083673112_1083673121 22 Left 1083673112 11:64310877-64310899 CCACCAATCTTAAACTTTGTGCA 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673115_1083673121 -2 Left 1083673115 11:64310901-64310923 CCTTCCCACTCTGAAGAACAGTG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673113_1083673121 19 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673114_1083673121 -1 Left 1083673114 11:64310900-64310922 CCCTTCCCACTCTGAAGAACAGT 0: 1
1: 0
2: 3
3: 22
4: 254
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673116_1083673121 -6 Left 1083673116 11:64310905-64310927 CCCACTCTGAAGAACAGTGAGCC 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673111_1083673121 29 Left 1083673111 11:64310870-64310892 CCAAAATCCACCAATCTTAAACT 0: 1
1: 0
2: 0
3: 23
4: 286
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253
1083673117_1083673121 -7 Left 1083673117 11:64310906-64310928 CCACTCTGAAGAACAGTGAGCCA 0: 1
1: 0
2: 4
3: 45
4: 343
Right 1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG 0: 1
1: 0
2: 2
3: 34
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083673121 Original CRISPR TGAGCCAGCCGGCCAGGGTG CGG Intronic
900786232 1:4652647-4652669 GGAGCCAGCAGGGCAGGGAGGGG - Intergenic
901658824 1:10786179-10786201 TGGGACAGAAGGCCAGGGTGGGG - Intronic
902823982 1:18960035-18960057 GGAGCCAGCCTGCCAGTGTCTGG - Intergenic
902935766 1:19763546-19763568 TGAGCCAGGGTGCCAGGGTGAGG + Intronic
903847458 1:26286980-26287002 TGAGCCACCACGCCAGGCTGAGG + Intronic
903948788 1:26981562-26981584 TGGGCCTGAAGGCCAGGGTGAGG - Intergenic
904160515 1:28519066-28519088 TGAGCCTCCTGGGCAGGGTGGGG - Intronic
904202285 1:28828529-28828551 TGAGTCAGCCTGGCTGGGTGCGG + Intronic
905186480 1:36200674-36200696 AGCACCAGCCAGCCAGGGTGTGG + Intergenic
905195134 1:36270308-36270330 TGAGCCAGCCAGGGAGGTTGAGG + Intronic
905300152 1:36981396-36981418 TGAGCCAGCCAGCCAAGGTCAGG + Intronic
905945193 1:41895728-41895750 TGAGGCATCAGGACAGGGTGTGG + Intronic
906138172 1:43515126-43515148 AGAGCCAGCCTGGCAGGGAGAGG - Intergenic
906365546 1:45206480-45206502 CGAGCCAGCCGGCCCGAGTGGGG + Exonic
906720964 1:48004301-48004323 TGAGCATGCAGGCCCGGGTGAGG + Intergenic
906792174 1:48668593-48668615 TAAGCCAGACGGCCAAGATGGGG - Intronic
907098283 1:51802068-51802090 TGAGCCACCGCGCCAGGCTGAGG + Intronic
911037956 1:93569901-93569923 AGAGCCAACAGGCCAGGCTGTGG - Intronic
911042087 1:93599082-93599104 TGGGCCAGCTGGCCACGGTCAGG - Intronic
911224122 1:95285774-95285796 TGAGCCAGCAGGAAAGAGTGCGG + Intergenic
912271610 1:108216252-108216274 TGTGCAAGACAGCCAGGGTGGGG + Intergenic
912369759 1:109164808-109164830 GAAGCCAGGCTGCCAGGGTGAGG + Intronic
915248226 1:154570826-154570848 GGAGCCAGGAGGCCAGAGTGAGG - Intronic
915549295 1:156623484-156623506 TGAGCCAGCCTGGCATGATGGGG - Exonic
916054680 1:161060228-161060250 TTACCCAGCAGGCCAGAGTGCGG - Intronic
916463640 1:165050484-165050506 TGAGCCGGCTGGCCAGGAGGAGG + Intergenic
918238836 1:182604232-182604254 TGGGGAAGGCGGCCAGGGTGCGG + Exonic
920171741 1:204076239-204076261 TGATCCAGCAGCCCAGGCTGAGG - Intronic
922100533 1:222474262-222474284 TGCCCCAGGAGGCCAGGGTGAGG + Intergenic
922119039 1:222644243-222644265 GGAGCCGGCCGGCGAGGGCGGGG - Intronic
922193394 1:223339443-223339465 TGAGCCAGCGGGGCAGGGGTGGG + Intronic
922726989 1:227927263-227927285 TGTGCCAGGCTGCCAGGGAGTGG + Intronic
922766269 1:228158166-228158188 TGAGCCCGCCGACCTGGGCGAGG + Exonic
923629953 1:235643119-235643141 ACAGCCAGACGGCCAAGGTGGGG + Intronic
1065383057 10:25109356-25109378 TGAGCCACCTCGCCAGGCTGTGG - Intergenic
1067694094 10:48523244-48523266 CTATCCAGCAGGCCAGGGTGGGG + Intronic
1067907349 10:50307277-50307299 TGAACCTCCTGGCCAGGGTGTGG - Exonic
1070028499 10:72654551-72654573 TGAGCCACCTTGCCAGGCTGTGG + Intergenic
1070593995 10:77819871-77819893 TGAGTCAGCCAGCCAGGGGCTGG - Intronic
1070624552 10:78041368-78041390 TGGGCCTGCTGGCCAGGGGGTGG + Intronic
1071775981 10:88788469-88788491 TGAGCCAGCAAGACAGGGAGAGG - Intergenic
1073266670 10:102231786-102231808 TGAGTCTGGGGGCCAGGGTGGGG + Exonic
1074527374 10:114274124-114274146 ACAGCCAGACGGCCAGGGAGGGG + Intronic
1076546013 10:131246143-131246165 TGAGCCACACAGCCAGGCTGAGG - Intronic
1076706031 10:132302023-132302045 TGACCCAGCCGGCCTGGGGTGGG - Intronic
1077009123 11:372427-372449 TGTGCCGGCCGGTCAGTGTGTGG + Intronic
1077184315 11:1229491-1229513 TGAGCCAGCTGGGCATGGTGGGG + Intronic
1077185787 11:1234785-1234807 GGGGCCAGCTGGCCAGGGTGAGG + Intronic
1077467246 11:2739201-2739223 TGAGCCAGCCAGGATGGGTGGGG - Intronic
1078211903 11:9276581-9276603 TGAGCCAGCAGGCCAAGGAGTGG - Intergenic
1080036785 11:27719521-27719543 TGAGGCATCCGGCCCGGCTGGGG + Intronic
1083163020 11:60867349-60867371 TGAGACAGAAAGCCAGGGTGAGG + Intergenic
1083477395 11:62923134-62923156 TCACCCAGCCGGTCAGGGTTGGG + Intergenic
1083663210 11:64261685-64261707 TGGGCGGGCAGGCCAGGGTGGGG + Intronic
1083673121 11:64310922-64310944 TGAGCCAGCCGGCCAGGGTGCGG + Intronic
1085280347 11:75325914-75325936 TGAGTCAGCCGGCCCGAGTTGGG - Intronic
1085323511 11:75589234-75589256 TGAGGCAGACGGCCACAGTGAGG - Intronic
1086914352 11:92511641-92511663 CCAGCCAGCCATCCAGGGTGGGG - Intronic
1090005425 11:122998335-122998357 TGAGCCACCCTGCCTGGCTGGGG - Intergenic
1091291302 11:134441400-134441422 TAAGCCAGCAGGCCTGGGTGGGG - Intergenic
1091742753 12:2971756-2971778 TGAGCCACCCCGCCTGGCTGTGG + Intronic
1091985970 12:4910457-4910479 CAAGCCAGCCGGCCAGGTAGGGG + Exonic
1092214022 12:6667854-6667876 TGGGGCAGCCCCCCAGGGTGGGG - Exonic
1097184873 12:57191153-57191175 GGAGCAAGCTGGACAGGGTGGGG - Intronic
1102490723 12:113288246-113288268 TGGACCTGCAGGCCAGGGTGGGG - Intronic
1102913748 12:116737874-116737896 TGAACCTGGCGGCCATGGTGTGG - Exonic
1103466830 12:121148760-121148782 TGGTCCACCCGGCCATGGTGGGG - Intronic
1103767224 12:123288973-123288995 TCAGGGAGCCAGCCAGGGTGGGG - Intergenic
1103939500 12:124494247-124494269 TGACCCTGCCGGCCACCGTGGGG - Intronic
1103986088 12:124768496-124768518 TGAGCCTGACGGCCAGGGGGAGG - Intergenic
1104049575 12:125186533-125186555 CGGGGCAGCCGGCCAGGGCGCGG + Intergenic
1104346182 12:128001228-128001250 TGAGGCACCCAGCCAGGCTGGGG + Intergenic
1106526117 13:30542630-30542652 TCAGCCAGCCAGCCAGGCTGTGG - Intronic
1107986867 13:45783595-45783617 TGAAGCAGTCGGCCTGGGTGGGG + Exonic
1108618602 13:52159511-52159533 AGAGGCAGCCCGCCAGGGCGGGG + Intronic
1108771829 13:53711885-53711907 TGATCCAGTAGGTCAGGGTGGGG - Intergenic
1109798381 13:67344730-67344752 TGTGACAGTAGGCCAGGGTGTGG - Intergenic
1112365657 13:98752884-98752906 TGAGTCAGCTGGCCGGGGGGTGG - Intergenic
1112711264 13:102131479-102131501 TGAGACAGCAGACCAGGCTGGGG - Intronic
1113311525 13:109137895-109137917 AGAACCAACAGGCCAGGGTGAGG - Intronic
1114483369 14:23048507-23048529 TGAGCCAGCAGGGCCGGGAGCGG + Intronic
1114558952 14:23577681-23577703 AGAGCCACCGGGCCAGGGAGCGG - Intronic
1115577600 14:34726160-34726182 TGAGCCCTCTGTCCAGGGTGGGG + Intergenic
1115721875 14:36170833-36170855 TGTGCCAACCGCCCAGGGTCTGG - Intergenic
1115820523 14:37207827-37207849 TGAGCCACCATGCCAGGCTGAGG + Intronic
1118568999 14:67173516-67173538 TGTGCCAGCTGGGAAGGGTGTGG - Intronic
1119730389 14:76947476-76947498 TGAGGCAGAAGGGCAGGGTGGGG - Intergenic
1121284739 14:92726468-92726490 TGAGCCAGACAGCAATGGTGAGG + Intronic
1121491893 14:94367061-94367083 AGACCCAGCCGGCCAGGCTGAGG - Intergenic
1121676589 14:95758560-95758582 TGAGCCATCCTGAGAGGGTGTGG - Intergenic
1122792937 14:104192093-104192115 GGAGCCAGCGGCACAGGGTGGGG + Intergenic
1122793061 14:104192566-104192588 TGCTCCAGCTGGCCAGGCTGTGG - Intergenic
1122835407 14:104428383-104428405 GGAGCCCCCAGGCCAGGGTGGGG - Intergenic
1123509112 15:20978243-20978265 TGGGCCAACATGCCAGGGTGTGG - Intergenic
1123566334 15:21551990-21552012 TGGGCCAACATGCCAGGGTGTGG - Intergenic
1123602598 15:21989276-21989298 TGGGCCAACATGCCAGGGTGTGG - Intergenic
1124490482 15:30152024-30152046 TGAGCCATGCTGCCAGGGTGGGG - Intergenic
1124753051 15:32386305-32386327 TGAGCCATGCTGCCAGGGTGGGG + Intergenic
1124974796 15:34522005-34522027 TGAGCCATGCTGCCAGGGTGGGG + Intergenic
1127588263 15:60397987-60398009 AGAGCCGGCTGGCCTGGGTGGGG + Intronic
1129445779 15:75616859-75616881 CCAGCCAGCTGGCCAAGGTGAGG - Intronic
1129461181 15:75700746-75700768 AGACCCAGCCCGCCAGGCTGGGG - Intronic
1129658716 15:77541473-77541495 TGCCCCAGCAGGCCCGGGTGTGG + Intergenic
1129709341 15:77812546-77812568 TGACCCACACCGCCAGGGTGGGG - Intronic
1130853618 15:87821610-87821632 TGAGGCTGCTGGCCAGGATGGGG - Intergenic
1131564632 15:93474902-93474924 TTTGCCAGCCGGCCAGCATGTGG - Intergenic
1132284756 15:100654708-100654730 TGAGTCAGCCATCCAGAGTGTGG - Intergenic
1202974703 15_KI270727v1_random:279078-279100 TGGGCCAACATGCCAGGGTGTGG - Intergenic
1133326147 16:4943529-4943551 AGGGCCAGCCTGCCGGGGTGGGG + Intronic
1134502108 16:14777391-14777413 CCAGCCAGGCGGCCAGAGTGAGG - Intronic
1138122439 16:54411432-54411454 TGAGCTAGTGGGGCAGGGTGGGG + Intergenic
1139848272 16:69935550-69935572 GGAGCCAGCCGGCCAGCGTGCGG + Intronic
1140376542 16:74449593-74449615 TCACTCAGCTGGCCAGGGTGGGG - Intergenic
1140927791 16:79599991-79600013 TGAGCCAGCTTGCCGGGCTGGGG + Exonic
1141356377 16:83350276-83350298 TGCCCCACCCGTCCAGGGTGGGG - Intronic
1141610910 16:85180693-85180715 GGAGCCAGGCAGCCTGGGTGCGG - Intronic
1141629005 16:85276804-85276826 TGAGTCAGGGGGCCTGGGTGGGG - Intergenic
1141660061 16:85436823-85436845 GGAGCCCGCAGGCCAGAGTGTGG + Intergenic
1142150265 16:88509574-88509596 TGAGCCAGCCTGCCAGGGCCAGG + Intronic
1142175002 16:88641045-88641067 TGAGCCAGGGGGCCAGGCAGGGG - Intergenic
1142231168 16:88900959-88900981 TGAGCACGGGGGCCAGGGTGGGG - Intronic
1142398967 16:89849250-89849272 TGTGCCACACTGCCAGGGTGGGG - Intronic
1142889381 17:2933089-2933111 TGAGCCAGCCAGCCAGACAGTGG + Intronic
1143181548 17:4987151-4987173 CTAGGCAGCCTGCCAGGGTGCGG + Intronic
1143416660 17:6755757-6755779 GAAGCCAGCCAGCCAGGGTGAGG + Intronic
1143658792 17:8312395-8312417 TGACCCAGACGGCTTGGGTGGGG - Exonic
1144273642 17:13643949-13643971 TGACCCAGCAGGTCAGGGTGGGG - Intergenic
1147328921 17:39684940-39684962 TGTGCCTGCTGGCCAGGATGGGG - Intronic
1147430444 17:40367284-40367306 TGAGGCGGTGGGCCAGGGTGGGG + Intergenic
1148156141 17:45426129-45426151 TGAACCTGCTGGCCAGGGTGGGG + Intronic
1150220152 17:63491471-63491493 GGAGCCAGCAGGGCAGGATGGGG + Intronic
1150387810 17:64774748-64774770 TGAACCTGCTGGCCAGGGTGGGG + Intergenic
1150765055 17:67995875-67995897 CGAGCAAGCCGGGCAGGCTGGGG - Intergenic
1151412667 17:73941623-73941645 GGAGCCAGCCTGCAAGGGTGTGG - Intergenic
1151658905 17:75508433-75508455 TGGGCCGGTGGGCCAGGGTGGGG - Intronic
1151697640 17:75725987-75726009 GGAGGCAGCAGGCCAGGGGGTGG + Intronic
1151817475 17:76478423-76478445 TGAGCTCGCAGCCCAGGGTGAGG - Intronic
1151970478 17:77455006-77455028 TAGGCCGGCCGGCCAGGGGGAGG - Intronic
1152349831 17:79778338-79778360 TGAGCCAGACGGACAGCGGGCGG - Intronic
1152409836 17:80117755-80117777 TGGGCCAGGCGGCTATGGTGGGG + Intergenic
1152565226 17:81097386-81097408 AGAACCAGCCTGGCAGGGTGTGG - Intronic
1152754298 17:82080725-82080747 TGAGCCGGGAGGCCAGGCTGTGG + Exonic
1154389047 18:13920836-13920858 GGAGCCAGACTGCCCGGGTGTGG + Intergenic
1156449843 18:37260850-37260872 GGAGCCAGCAGTCCAGGGAGGGG - Intronic
1157588916 18:48824407-48824429 TGAGCCAACATGCCAGGCTGTGG + Intronic
1157736570 18:50054895-50054917 GGAGCCAGCCTGCCTGGGTTGGG - Intronic
1160798186 19:955235-955257 TCGGCCAGCTGGCCAGGGCGGGG + Intronic
1161224418 19:3136444-3136466 TCAGCGAGCGGGCCATGGTGCGG - Exonic
1161326597 19:3667266-3667288 GGAGGCAGCAGGTCAGGGTGGGG + Intronic
1161400893 19:4065901-4065923 GGGGCCAGCCCGCCAGGGGGCGG - Intronic
1161490701 19:4559654-4559676 TGAGCCAGAAGGCCAGGGCAGGG - Exonic
1161560920 19:4972016-4972038 TGAGCCAGGAGCCTAGGGTGAGG - Intronic
1162715193 19:12626565-12626587 TGAGCCACCATGCCAAGGTGTGG + Intronic
1162725404 19:12687574-12687596 AGATCCAGCAGGCCAGGGGGAGG + Intergenic
1162755006 19:12852553-12852575 TGAGCCAGCATGCCAGGCTCTGG - Intronic
1162931759 19:13961066-13961088 TGGGCCAGCCGGCCAGGAAGAGG - Exonic
1163347118 19:16750212-16750234 TGGGCCAGCCTCCCAGAGTGTGG + Exonic
1163712251 19:18853810-18853832 GCAGCCTGCCGGCCAGAGTGGGG + Intronic
1165138721 19:33686740-33686762 TGAGTAAGCTGGCCACGGTGTGG - Intronic
1165648868 19:37468787-37468809 TGAGCCACCGTGCCAGGCTGAGG + Intronic
1166941405 19:46368436-46368458 TGAGGCAGGCAGCAAGGGTGTGG - Intronic
1167708079 19:51093700-51093722 TCAGCCAGGAGGCCAGGGAGAGG - Intergenic
1167720181 19:51174012-51174034 TGAGCCAGCGAGGCAGGGTGGGG + Intergenic
1168105677 19:54164530-54164552 TGGGCCAGCAAGCCAGGGTTTGG - Exonic
1168318740 19:55496022-55496044 TGAGCCACCCGGCCAGGTGCAGG + Intronic
925893763 2:8456405-8456427 TGAGGCTGCAGGCCTGGGTGGGG - Intergenic
926246123 2:11123486-11123508 CTAGCCAGCAGGCCAGGGTAAGG - Intergenic
930013824 2:46957399-46957421 AGAGCCAGCCTGCCAGTGAGAGG - Intronic
933698734 2:85239202-85239224 TGGACCAGCCCGCCAGGCTGAGG + Intronic
936985605 2:118309346-118309368 AGAGGCAACAGGCCAGGGTGGGG + Intergenic
938296916 2:130184250-130184272 GAAGACAGCCGGCCAGAGTGCGG + Intronic
938766178 2:134461853-134461875 TGAGGCTGCCAGCCAGGCTGTGG - Intronic
941105676 2:161349765-161349787 TGAGCCAGACGAGCAGGGTGGGG + Intronic
941177840 2:162221254-162221276 TGAGCGAGCCGGCCAGGCCTGGG - Intronic
941260141 2:163287495-163287517 AGGGCCAGCCAGCCAGGGTCTGG - Intergenic
942259623 2:174146008-174146030 TGAGCCAAACGGCCAGAGGGAGG + Intronic
943845026 2:192634748-192634770 GGAGCCAGCGGACCCGGGTGGGG + Intergenic
944399747 2:199311703-199311725 TGAGCAAGCGAGCCAGAGTGAGG - Intronic
944661230 2:201923576-201923598 TGAGCCAGGCAGCAGGGGTGTGG + Intergenic
944906113 2:204263985-204264007 TGAGGCAGCTGGCTTGGGTGTGG - Intergenic
947911996 2:233807702-233807724 AGACCCAGCCAGCCAGGGTGAGG - Intronic
948402211 2:237692287-237692309 GGAGCCAGCCCGCCGGGGAGCGG - Intronic
948990691 2:241552424-241552446 TGAGTGGGCCGGACAGGGTGTGG - Intergenic
949004257 2:241636722-241636744 GGACCCAGGCGGCCGGGGTGGGG + Intronic
1168790311 20:571898-571920 ACAGCTGGCCGGCCAGGGTGGGG - Intergenic
1170701956 20:18711895-18711917 TTAGCCAGGAGGCCGGGGTGGGG + Intronic
1172671284 20:36635851-36635873 TAAGCCAGCCAGGCAGAGTGAGG - Intronic
1174200831 20:48805372-48805394 TGAGCCACCCGGCCAAGGCCAGG + Intronic
1174917542 20:54669232-54669254 AGAGCCAGCCTGCCTGGGTTTGG + Intergenic
1175302182 20:57950876-57950898 TGAGACAGCCAGCCAGGAAGGGG + Intergenic
1175813577 20:61872137-61872159 TGTGCCAGAAGCCCAGGGTGCGG - Intronic
1176226770 20:64004732-64004754 TGAGCTTCCTGGCCAGGGTGGGG + Intronic
1178408893 21:32347754-32347776 GGAACCAGCCCTCCAGGGTGGGG + Exonic
1179715676 21:43286367-43286389 TGAGCCACCCACCCAGTGTGTGG + Intergenic
1179901127 21:44395367-44395389 TGAGCCAGGCGGCCCGGCTGGGG + Intronic
1181472958 22:23152143-23152165 AGAGGCAGGAGGCCAGGGTGTGG - Intronic
1183624570 22:38993697-38993719 TGAGACAGCTGGCCAAGGAGAGG + Intergenic
1183634756 22:39054511-39054533 TGAGCCACCTGGCCAGGCTTAGG + Intronic
1183698887 22:39438523-39438545 TGAGCCAGCAGTCCCAGGTGGGG + Intergenic
1183932133 22:41241139-41241161 TGGGCCAGCCCGACAGGGAGGGG + Intergenic
1184254614 22:43280046-43280068 TGAGCCAGCCAGTCAGGAGGAGG + Intronic
1184725986 22:46346745-46346767 TGTCCCTGCCGGCCATGGTGAGG + Intronic
1184849918 22:47114226-47114248 AAAGCCACACGGCCAGGGTGTGG + Intronic
1185014461 22:48335016-48335038 TGAGGCTGCCTCCCAGGGTGTGG + Intergenic
1185366165 22:50437902-50437924 TGAGCAAGCCGGGCTGTGTGGGG + Intronic
1185382174 22:50514585-50514607 TGGGCAAGCCAGCCAGGCTGAGG + Intronic
949093746 3:61205-61227 TGAGCCACCAGGCCAGGTTCAGG + Intergenic
949909198 3:8886889-8886911 TGAGCCAGCCAGGTAGGCTGGGG + Intronic
951685095 3:25335065-25335087 TCAGCCAGCCAGCATGGGTGGGG - Intronic
952316881 3:32239083-32239105 TGAGGAAGCCGGGCAGGGTGCGG - Exonic
952854996 3:37762853-37762875 TGACTCAGCAGGCCTGGGTGGGG - Intronic
953668033 3:44940101-44940123 TGAAACAGCAGGGCAGGGTGTGG - Intronic
954301977 3:49705022-49705044 TGAGCCAGCCGGGCCGGGGCAGG - Exonic
954399918 3:50313780-50313802 TGAGCCACCCCGCCAGGGCTGGG + Intergenic
954923778 3:54214653-54214675 TGAAGCATCCTGCCAGGGTGTGG + Intronic
961701303 3:128746810-128746832 TGAGCCACCCGGCCCGGCCGGGG + Intronic
961750907 3:129094144-129094166 TGATCCAGGCGGGCTGGGTGGGG - Intronic
962364779 3:134771495-134771517 TGATACAGCAGGTCAGGGTGGGG + Intronic
962449505 3:135500867-135500889 TAAGCCTGCAGGCCAGGGTTAGG + Intergenic
966372159 3:179261422-179261444 AGAGCCAGCCCGCCGGGGAGCGG + Intronic
968336371 3:197917030-197917052 TGAGCCACCCCACCAGGTTGGGG - Intronic
968470630 4:780942-780964 TGAGCCAGCCAGCCCGAGGGTGG + Intergenic
968612044 4:1561720-1561742 TGCTCCACCCGGCCAGGGAGAGG - Intergenic
968999530 4:3969139-3969161 TGACCCAGCCGACCAGGAAGTGG - Intergenic
969292780 4:6251525-6251547 TGAGCCAGCCTGCAGGGATGTGG + Intergenic
969651634 4:8471587-8471609 TGAGCCACAGAGCCAGGGTGGGG + Intronic
969754475 4:9139494-9139516 TGACCCAGCCGACCAGGAAGTGG + Intergenic
970333386 4:15005053-15005075 TGGGCCGGCGGCCCAGGGTGCGG - Intronic
972285815 4:37647006-37647028 TGAGCCACCGTGCCAGGCTGAGG + Intronic
980975310 4:139605302-139605324 TGAGCCACCCGGCCCGGATGTGG + Intronic
982746022 4:159104111-159104133 GGAGGAGGCCGGCCAGGGTGCGG + Intergenic
986243140 5:5979545-5979567 TGAGTCAGCCAGCCTGGCTGTGG - Intergenic
992564805 5:77986526-77986548 GGGGCCAGCAGGTCAGGGTGTGG + Intergenic
992685221 5:79193115-79193137 TTAGCCAGGCGGGCCGGGTGCGG + Intronic
993308925 5:86303751-86303773 TGTGCAAGACAGCCAGGGTGGGG - Intergenic
995043130 5:107611747-107611769 TGAGGCAGCAGGCCAGGGCTCGG + Intronic
996019161 5:118573174-118573196 TGGGCCAGCCTACCGGGGTGTGG - Intergenic
1001057477 5:168461589-168461611 TGAGCCATCCGGATGGGGTGGGG + Intronic
1003547230 6:7069702-7069724 TGAGCCACCCTGCCTGGCTGAGG + Intergenic
1003952656 6:11130512-11130534 TGGCTCAGCTGGCCAGGGTGGGG + Intronic
1006258701 6:32851217-32851239 TGAGCCAGGATGCCAGGGTCAGG + Intronic
1006677034 6:35771790-35771812 TGAGCCAGGGGTGCAGGGTGAGG - Intergenic
1007428835 6:41764590-41764612 TGAGCCTAATGGCCAGGGTGAGG + Intergenic
1017502892 6:155041952-155041974 TGAGCCAGCCTGCCAGAGTGAGG - Intronic
1018686440 6:166307849-166307871 GGAGCCTGCCGGCCGGGGCGGGG + Exonic
1019287412 7:230551-230573 TGAGGTGGCCGGCCAGGGTGAGG - Intronic
1019298626 7:291572-291594 TGAGCCAGGAAGCCAGGGTTCGG + Intergenic
1019552454 7:1609975-1609997 TGAGCCAGCCCGCAACTGTGGGG - Intergenic
1019889946 7:3938357-3938379 TGAGCCACCGTGCCAGGCTGAGG - Intronic
1020007570 7:4790625-4790647 TGACCCAGGAGGCCTGGGTGGGG + Intronic
1021717654 7:23474112-23474134 TGAGTCCGCCGGCCAGCGCGGGG + Intergenic
1022018463 7:26376281-26376303 CGAGCCAGCCGGCCTCGGTCCGG + Intergenic
1022389138 7:29928257-29928279 TGATTCAGCAGGACAGGGTGGGG - Intronic
1026573088 7:71548947-71548969 TGAGCCAGGAAGCCAGGGAGTGG + Intronic
1026681141 7:72467446-72467468 TGGGCCAGCCAGCCAGGTGGAGG + Intergenic
1028921262 7:96313165-96313187 TGAGACAGCCACCCAGGCTGAGG + Intronic
1029187668 7:98751397-98751419 TGAGCCACCTGGCCAGGATATGG + Intergenic
1031089529 7:117337677-117337699 AGAGTCAGCCTCCCAGGGTGGGG + Intergenic
1032023457 7:128422879-128422901 TGAGCCAGCAGGGGAGGGTCTGG + Intergenic
1034419000 7:150979244-150979266 CGAGCCAGCTGGCCGGGGGGAGG - Intergenic
1035694710 8:1586379-1586401 AGAGCCAGCTGGACGGGGTGTGG + Intronic
1036744005 8:11391185-11391207 TGACCCAGCAGGTCTGGGTGGGG - Intronic
1040560527 8:48519795-48519817 TGAGCCAGGTGACCTGGGTGAGG + Intergenic
1045519192 8:102888629-102888651 TGAGCCAGCAGGCCTGGCTGAGG - Intronic
1049015686 8:139918509-139918531 TGAGCAAACCGGCCAGAGCGAGG + Intronic
1049357406 8:142195628-142195650 TGTGCCAGCTGGGCAGGGTGAGG - Intergenic
1049617009 8:143579988-143580010 TGAGTGAGCCGGCCGGGGAGAGG - Intronic
1054822070 9:69532531-69532553 TGAGCCAGAAGCCCAGAGTGTGG - Intronic
1056134950 9:83622798-83622820 GGATCCGGCCTGCCAGGGTGAGG + Intergenic
1056795336 9:89655160-89655182 TCAGCCATACGGCCAGAGTGGGG - Intergenic
1057533559 9:95876024-95876046 GGATCCATCCGGCCAGGGGGAGG - Exonic
1059953743 9:119494680-119494702 AGGGCCAGCCAGCCAGGTTGTGG + Intergenic
1060191060 9:121593036-121593058 TGGGCCAGCCTCCCTGGGTGTGG + Intronic
1060736341 9:126068818-126068840 TGAGCCAGCAGGGCAGGATCAGG + Intergenic
1061309757 9:129754516-129754538 TGAGCCACCTGGCCAAGGTGAGG - Intergenic
1062136793 9:134933382-134933404 GGAGCCAGCGGGGCAGGGTGGGG - Intergenic
1062279349 9:135745004-135745026 TGAGCCCGCCTCCCAGGGTGGGG + Intronic
1190373319 X:49763950-49763972 TGAGCCACCATGCCTGGGTGAGG + Intergenic
1192288417 X:69764020-69764042 TGAGCTAGCCAGGAAGGGTGAGG + Intronic
1192559978 X:72121533-72121555 TGAGTCAGCAGCCCAGGGTGGGG - Intergenic
1196399124 X:115295360-115295382 TGAGCCACCGTGCCAGGCTGAGG + Intronic
1196668880 X:118345554-118345576 TGATCCTGCCGGCCAGAGGGTGG - Intergenic
1197631765 X:128869181-128869203 TGAGCCACCATGCCCGGGTGAGG + Intergenic
1199608157 X:149592970-149592992 TGACCCAGCCGGCCGGCGAGTGG - Exonic
1199630963 X:149776390-149776412 TGACCCAGCCGGCCGGCGAGTGG + Exonic
1199744169 X:150761491-150761513 TGAGCCAGAGGGCCAGGCTGGGG + Intronic
1200184535 X:154173684-154173706 TTAGCCACACAGCCAGGGTGTGG + Intergenic
1200190187 X:154210822-154210844 TTAGCCACACAGCCAGGGTGTGG + Intergenic
1200195940 X:154248624-154248646 TTAGCCACACAGCCAGGGTGTGG + Intergenic
1200201594 X:154285742-154285764 TTAGCCACACAGCCAGGGTGTGG + Intronic