ID: 1083673122

View in Genome Browser
Species Human (GRCh38)
Location 11:64310923-64310945
Sequence GAGCCAGCCGGCCAGGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 2, 2: 4, 3: 31, 4: 356}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083673112_1083673122 23 Left 1083673112 11:64310877-64310899 CCACCAATCTTAAACTTTGTGCA 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673111_1083673122 30 Left 1083673111 11:64310870-64310892 CCAAAATCCACCAATCTTAAACT 0: 1
1: 0
2: 0
3: 23
4: 286
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673114_1083673122 0 Left 1083673114 11:64310900-64310922 CCCTTCCCACTCTGAAGAACAGT 0: 1
1: 0
2: 3
3: 22
4: 254
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673115_1083673122 -1 Left 1083673115 11:64310901-64310923 CCTTCCCACTCTGAAGAACAGTG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673116_1083673122 -5 Left 1083673116 11:64310905-64310927 CCCACTCTGAAGAACAGTGAGCC 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673113_1083673122 20 Left 1083673113 11:64310880-64310902 CCAATCTTAAACTTTGTGCACCC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356
1083673117_1083673122 -6 Left 1083673117 11:64310906-64310928 CCACTCTGAAGAACAGTGAGCCA 0: 1
1: 0
2: 4
3: 45
4: 343
Right 1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG 0: 1
1: 2
2: 4
3: 31
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083673122 Original CRISPR GAGCCAGCCGGCCAGGGTGC GGG Intronic
900093925 1:932749-932771 GAGCCAGCCAGACAGGGCGAAGG - Intronic
900145217 1:1156294-1156316 GAACCAGCGGGCTGGGGTGCTGG - Intergenic
900390630 1:2432387-2432409 GGGCCAGCAGGGCAGGGGGCTGG - Intronic
900544747 1:3222356-3222378 GCTCCAGCAGGCCTGGGTGCTGG + Intronic
900661463 1:3786566-3786588 GACCAACCAGGCCAGGGTGCAGG + Intronic
902491541 1:16785951-16785973 GAGGCAGACGGCCAGGGTTAAGG + Intronic
902507979 1:16950311-16950333 GACCCAGCCTCCCAGAGTGCTGG + Intronic
902823981 1:18960034-18960056 GAGCCAGCCTGCCAGTGTCTGGG - Intergenic
902930587 1:19728595-19728617 GATCCAGCCAGGCAGGGAGCAGG - Intronic
903521904 1:23957203-23957225 GAGCTAGCCTGAGAGGGTGCTGG + Intergenic
904040735 1:27583334-27583356 GAGCATGCCAGGCAGGGTGCCGG - Intronic
904044680 1:27602514-27602536 GAGCCAGAGGGGCAGGGGGCTGG - Intronic
904600433 1:31669853-31669875 GAAGGAGCCGGCCAAGGTGCCGG + Intronic
904605702 1:31696504-31696526 CAGACAGCTGGCCATGGTGCTGG + Intronic
905238736 1:36568295-36568317 AAGCCAGGCCTCCAGGGTGCTGG + Intergenic
905300153 1:36981397-36981419 GAGCCAGCCAGCCAAGGTCAGGG + Intronic
907395535 1:54187218-54187240 GAGCCAGGAGGAGAGGGTGCTGG - Intronic
911037955 1:93569900-93569922 GAGCCAACAGGCCAGGCTGTGGG - Intronic
911224123 1:95285775-95285797 GAGCCAGCAGGAAAGAGTGCGGG + Intergenic
912556884 1:110522950-110522972 GAGCCAGCCTGCCATGGCCCGGG - Intergenic
913661710 1:121010722-121010744 GGGCCAGCCGGGCAGAGGGCTGG + Intergenic
914013082 1:143793902-143793924 GGGCCAGCCGGGCAGAGGGCTGG + Intergenic
914164744 1:145167283-145167305 GGGCCAGCCGGGCAGAGGGCTGG - Intergenic
914651706 1:149702511-149702533 GGGCCAGCCGGGCAGAGGGCTGG + Exonic
917119830 1:171635830-171635852 GAGCCAGCCAGCCAGGGCCCAGG - Exonic
917979513 1:180260319-180260341 GTGCCAGACAGCCAGGGTGTAGG + Intronic
918316656 1:183328214-183328236 GAGCCAGGAAGCCAGGGTCCTGG - Intronic
919784472 1:201250629-201250651 GGGCCAGCTGGCCATGCTGCAGG + Intergenic
922737443 1:227995115-227995137 AGGCCAGCCGGCCAGGATGGAGG + Intergenic
923096763 1:230781151-230781173 GAGCCACCACGCCAGGCTGCAGG + Intronic
924368563 1:243322319-243322341 CAGCCAGTCTGCCAGGGTGGTGG + Intronic
924613449 1:245592253-245592275 AAGCCAGCCGCCCAGGGTGCAGG + Intronic
924708775 1:246518177-246518199 GAGGCAGCGGGCCTGGGTGGTGG - Intergenic
924813554 1:247423977-247423999 GAGCCAGCAGGAGAGGGAGCAGG + Exonic
1063167688 10:3478897-3478919 AAGGCAGCCAGCCAGGGAGCTGG - Intergenic
1063223405 10:3992390-3992412 GAGCCAGCCAGCCAATGTGGAGG - Intergenic
1063490408 10:6458625-6458647 GAGCCAGCCGGCCGTAATGCTGG - Intronic
1064384623 10:14879094-14879116 GAGCCGGCCGGGCAGGGAGGCGG - Intronic
1065932700 10:30493531-30493553 GAGACAGCTGGGCAGGGGGCTGG + Intergenic
1066211830 10:33247708-33247730 GTGACACCCAGCCAGGGTGCAGG - Intronic
1067787038 10:49257940-49257962 GAGCTACCCAGCCAGGGTTCTGG - Intergenic
1068485645 10:57655037-57655059 GAGCTAGTAGGGCAGGGTGCAGG + Intergenic
1069532824 10:69231494-69231516 GAGTCAGGCTGCCAGGCTGCCGG - Intronic
1070736174 10:78865288-78865310 GAGGCTGCCAGCAAGGGTGCAGG - Intergenic
1072097803 10:92199441-92199463 GATCCAGCCTGCCAAAGTGCTGG - Intronic
1072685834 10:97536404-97536426 GAGCCTGACAGCCAGGGTGAAGG + Intronic
1074185763 10:111098385-111098407 AAACCAGCTAGCCAGGGTGCTGG - Intergenic
1075576809 10:123583822-123583844 GACCCAGACCGCCAGGGGGCAGG + Intergenic
1075955811 10:126521982-126522004 GAGCCACCACGCCAGGCTGCCGG - Intronic
1076941633 10:133613978-133614000 GAGCCAGCCTGGCGGGGAGCTGG + Intergenic
1076998048 11:308653-308675 GAGCCAGCCAGCCAGCCTCCTGG - Intronic
1076999269 11:314572-314594 GAGCCAGCCAGCCAGCCTCCTGG - Intronic
1077000596 11:320328-320350 GAGCCAGCCAGCCAGCCTCCTGG + Intronic
1077128940 11:959761-959783 TAGCCACCAGGCCAGCGTGCTGG + Intronic
1077226827 11:1442239-1442261 GAAGGAGCCTGCCAGGGTGCAGG + Intronic
1077290010 11:1784723-1784745 CAGTCCGCCTGCCAGGGTGCCGG - Intergenic
1077465761 11:2732980-2733002 CAGCAAGCCAGCCAGGGTCCTGG + Intronic
1078594483 11:12674670-12674692 GCGCCAGCCGGCCCCGGGGCAGG + Exonic
1079592016 11:22192944-22192966 GAGCCAGCCGGGCCGGGGGGCGG + Intergenic
1080684238 11:34502347-34502369 GAGCCTGCTGGCCATGGAGCAGG + Intronic
1081812744 11:45922671-45922693 GCAGCCGCCGGCCAGGGTGCGGG - Intronic
1081816211 11:45944561-45944583 GAGCAAGCTGGCCAGGGTGGTGG - Intronic
1082806373 11:57454269-57454291 GAGCCACCGGGCCTGGCTGCTGG - Intergenic
1083153065 11:60805662-60805684 GAGCCAGGAAGTCAGGGTGCTGG - Intergenic
1083659788 11:64246727-64246749 GAGCCAGCCGGCGGGCGTCCCGG - Exonic
1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG + Intronic
1083726772 11:64632603-64632625 GAGCCAGGCTGGCAGAGTGCCGG + Intronic
1083822928 11:65182758-65182780 GAAGCAGCGGGCCAGGGAGCTGG + Exonic
1084363488 11:68683972-68683994 GCACAAGCCGGCCAGGGCGCAGG + Intronic
1084769870 11:71335584-71335606 GAGTCAGCTGACCAGGGTGGAGG - Intergenic
1084787610 11:71452743-71452765 GCGCCATCCGCCCAGGGTGGCGG + Intronic
1085745239 11:79109466-79109488 TAGCAAGCAGGCCAAGGTGCAGG + Intronic
1086914351 11:92511640-92511662 CAGCCAGCCATCCAGGGTGGGGG - Intronic
1088780067 11:113125647-113125669 GAGCCCGCTGGGCAGAGTGCAGG + Intronic
1089123933 11:116162772-116162794 GAGGCAGCCGGGCTGGGGGCTGG - Intergenic
1090381150 11:126328544-126328566 GCCCCAGCCACCCAGGGTGCAGG - Intronic
1090472990 11:126996555-126996577 GAGGGAGCCAGCCAGGGTGAAGG - Intronic
1090642054 11:128738240-128738262 GAGCCAGAGGTCCAGGGTTCTGG - Intronic
1091231996 11:133994153-133994175 GCGCCAGCCCTCCAGGCTGCAGG + Intergenic
1091985971 12:4910458-4910480 AAGCCAGCCGGCCAGGTAGGGGG + Exonic
1092119678 12:6035086-6035108 GAGCCAGGCAGCCAGGGAGGAGG + Intronic
1094434383 12:30405082-30405104 GACCTAGCCGGGCAGGGTGGCGG - Intergenic
1096100439 12:48967737-48967759 GAGCTAGCAGGCCAGTGTGGTGG - Intronic
1096199844 12:49673713-49673735 AAGCCAGCTGGCCAGTGAGCAGG + Intronic
1096542381 12:52314966-52314988 GAGCCAGCAGACCGGGGTTCTGG + Intronic
1098210035 12:68153780-68153802 GAACCAGCAGACCAGTGTGCTGG - Intergenic
1101178685 12:102185936-102185958 GAGCCACCCGGCCCAGCTGCTGG + Intronic
1101594072 12:106148215-106148237 GAGCCAGCCTGCCCGGCAGCCGG + Intergenic
1101940756 12:109097752-109097774 GAGCCGGCCGTCCAGGGGACCGG + Exonic
1102049557 12:109852792-109852814 AGGCCAGCAGGCCAGGGTTCTGG + Intronic
1102911473 12:116717715-116717737 CAGCCATCGGGCCAGGCTGCAGG - Exonic
1103339757 12:120215192-120215214 GAGCCAGCTGGACAGCATGCTGG - Exonic
1103463193 12:121121527-121121549 GAGGCAGCCTGCCTGGGTGCTGG - Intergenic
1103920657 12:124397507-124397529 GAGCCAGCAGGCATTGGTGCTGG - Intronic
1103959059 12:124596452-124596474 GATGCAGCCAGCCAGGATGCTGG + Intergenic
1103986087 12:124768495-124768517 GAGCCTGACGGCCAGGGGGAGGG - Intergenic
1104049576 12:125186534-125186556 GGGGCAGCCGGCCAGGGCGCGGG + Intergenic
1104996649 12:132662126-132662148 AAGCCATCCAGCCATGGTGCTGG + Intronic
1105214083 13:18274221-18274243 GAGGCATCCGCACAGGGTGCAGG + Intergenic
1105578490 13:21673927-21673949 GAGCCAGGCGGAAAGGGAGCCGG - Intronic
1105631763 13:22176345-22176367 GAGCCAGCCTGCCAGCCTGAAGG + Intergenic
1106025089 13:25948782-25948804 GAGCCAGCATGCCTGGGTTCTGG - Intronic
1106405015 13:29465732-29465754 GAGCCAGCCAGCCGGCATGCTGG + Intronic
1106422069 13:29593043-29593065 CAGCCACCCGTCCAGGCTGCTGG - Intronic
1112077772 13:95931715-95931737 GCGCCCGCCGGCCTGAGTGCAGG + Intronic
1113257535 13:108523395-108523417 GAGACTGCCGGCCAGGGCACTGG - Intergenic
1113311524 13:109137894-109137916 GAACCAACAGGCCAGGGTGAGGG - Intronic
1113803110 13:113096594-113096616 GAGCCGGACGGACAGGCTGCTGG - Exonic
1114483370 14:23048508-23048530 GAGCCAGCAGGGCCGGGAGCGGG + Intronic
1114602874 14:23970207-23970229 GAGGCACCGGGCCGGGGTGCAGG - Intronic
1114607239 14:24007336-24007358 GAGGCACCGGGCCGGGGTGCAGG - Intergenic
1114736669 14:25049837-25049859 GAGCCAGGCGGTCAGGGCGGAGG - Intronic
1117734012 14:58751300-58751322 AAGCCTGACGGCCAGGCTGCCGG + Intergenic
1119341928 14:73886720-73886742 GACCCAGACGTCAAGGGTGCTGG - Exonic
1119472213 14:74907216-74907238 GGGCCAGGCTGCCAGGGAGCAGG - Intronic
1120889668 14:89480472-89480494 GAGCCAGCTGGCCAGGTTATAGG - Intronic
1121491892 14:94367060-94367082 GACCCAGCCGGCCAGGCTGAGGG - Intergenic
1121823382 14:96990079-96990101 GAGCCATGTGACCAGGGTGCAGG - Intergenic
1122174739 14:99908651-99908673 AATCCAGTAGGCCAGGGTGCGGG + Intronic
1122263802 14:100537618-100537640 AAGGCAGCCGTCCAGGGAGCTGG + Exonic
1122523698 14:102364391-102364413 GAGCCAGCCTGGCACAGTGCTGG - Intronic
1122792938 14:104192094-104192116 GAGCCAGCGGCACAGGGTGGGGG + Intergenic
1122835406 14:104428382-104428404 GAGCCCCCAGGCCAGGGTGGGGG - Intergenic
1124249476 15:28097473-28097495 GAGCCTGGAGGCCAGGGGGCAGG - Intronic
1124343165 15:28902971-28902993 GATGCAGCCTGCCTGGGTGCTGG + Intronic
1125271593 15:37944717-37944739 GAGCCAGCCAGGCATGGTGGTGG - Intronic
1128314310 15:66650679-66650701 GAGTCAGACGGCCAGGAGGCTGG - Intronic
1129727293 15:77908053-77908075 GTGCCAGCCAGTGAGGGTGCTGG + Intergenic
1129799532 15:78403615-78403637 GAGCCAGCGGCCAAGGGTTCAGG - Intergenic
1129840586 15:78740942-78740964 GTGCCAGCCAGTGAGGGTGCTGG - Intergenic
1130270358 15:82442997-82443019 GTGCCGGCCGGTGAGGGTGCTGG - Intergenic
1130462702 15:84170316-84170338 GTGCCGGCCGGTGAGGGTGCTGG - Intergenic
1130467970 15:84202226-84202248 GTGCCGGCCGGTGAGGGTGCTGG + Intergenic
1130489976 15:84424471-84424493 GTGCCGGCCGGTGAGGGTGCTGG + Intergenic
1130496296 15:84471316-84471338 GTGCCGGCCGGTGAGGGTGCTGG - Intergenic
1130501562 15:84503221-84503243 GTGCCGGCCGGTGAGGGTGCTGG + Intergenic
1130590262 15:85206824-85206846 GTGCCGGCCGGTGAGGGTGCTGG + Intergenic
1131995056 15:98125444-98125466 GAAGCAGCCCTCCAGGGTGCAGG + Intergenic
1132258484 15:100400108-100400130 CAGCCAGCCAGCCTGGGGGCTGG - Intergenic
1132755521 16:1482674-1482696 GTGCCAGCTGGGCAGGGTCCAGG + Intergenic
1132939901 16:2501414-2501436 TCGCCAGCCAGCCAGGCTGCAGG - Exonic
1132949502 16:2552969-2552991 GAGCCAGCGTGCGAGGCTGCTGG + Intronic
1132964846 16:2647197-2647219 GAGCCAGCGTGCGAGGCTGCTGG - Intergenic
1133233254 16:4376278-4376300 GAGCCAGCCGTCCTGGCCGCCGG + Intronic
1133326148 16:4943530-4943552 GGGCCAGCCTGCCGGGGTGGGGG + Intronic
1134502107 16:14777390-14777412 CAGCCAGGCGGCCAGAGTGAGGG - Intronic
1134680370 16:16120700-16120722 GAGGCAGGCGGCCTGTGTGCAGG + Intronic
1137237300 16:46626308-46626330 GAGCCAGCCCTCCTGGGTACCGG - Intergenic
1137734119 16:50711552-50711574 GAGCCAGTCTGCCCAGGTGCAGG - Exonic
1138657741 16:58500673-58500695 GGGCCATCAGGCCAGGGGGCGGG + Intronic
1139848273 16:69935551-69935573 GAGCCAGCCGGCCAGCGTGCGGG + Intronic
1140395218 16:74620566-74620588 GAGCCACACGGCCAGGGCACAGG + Intergenic
1141393676 16:83685762-83685784 AAGTCAGCCGGGCATGGTGCAGG - Intronic
1141660062 16:85436824-85436846 GAGCCCGCAGGCCAGAGTGTGGG + Intergenic
1142139563 16:88466814-88466836 GAGGCTGCCGGCCAGGGGGCAGG - Intronic
1142150266 16:88509575-88509597 GAGCCAGCCTGCCAGGGCCAGGG + Intronic
1142327444 16:89425284-89425306 GAGCCAGCCAGCCTGGTTTCAGG - Intronic
1142693601 17:1621367-1621389 GAGCCCCCCCTCCAGGGTGCGGG + Intronic
1143013496 17:3879307-3879329 CAGCCAGCTGGCCAGGGAGGAGG - Intronic
1143106011 17:4530933-4530955 CAGCCAGCTGGCCAGGGAGCAGG - Intronic
1143416661 17:6755758-6755780 AAGCCAGCCAGCCAGGGTGAGGG + Intronic
1144847055 17:18225574-18225596 GCGCCAGGCGGCCCGGGCGCGGG - Exonic
1145248721 17:21285757-21285779 CAGCCGCCAGGCCAGGGTGCTGG + Intronic
1145754420 17:27380438-27380460 GAGGACGCCGGTCAGGGTGCTGG + Intergenic
1147132377 17:38417142-38417164 GATCCAGCCTGCCAGGGAGGAGG + Intergenic
1147339385 17:39744774-39744796 TTTCCAGCAGGCCAGGGTGCAGG - Intronic
1147341604 17:39755899-39755921 GGGCCAGGGGGCCAGGGTACTGG + Intergenic
1147449341 17:40494098-40494120 GTGCCAGAGGGCCTGGGTGCTGG + Intronic
1147559299 17:41499181-41499203 GGGGCAGATGGCCAGGGTGCCGG + Intergenic
1148505450 17:48123497-48123519 CTGCCAGCCGGCTAGGCTGCTGG + Intergenic
1149895699 17:60426796-60426818 CAGCCAGCCGGCCAAGTTCCTGG + Exonic
1150601458 17:66654482-66654504 GAGGCAGCTGGGCAGGCTGCGGG - Intronic
1151412666 17:73941622-73941644 GAGCCAGCCTGCAAGGGTGTGGG - Intergenic
1151997325 17:77618252-77618274 GAGCCAGTGGGCAAAGGTGCTGG - Intergenic
1152407243 17:80104762-80104784 GAGCCAGCAGACCAGGGCCCCGG + Intergenic
1152565225 17:81097385-81097407 GAACCAGCCTGGCAGGGTGTGGG - Intronic
1152595256 17:81234664-81234686 GGACCAGCCTGCCAGGGTGGAGG - Intronic
1152732117 17:81977558-81977580 CAGCCACGCGGCCAGGGGGCGGG - Exonic
1157502705 18:48202502-48202524 AAGCCAGCTGGGCAGGGTCCTGG + Intronic
1157545753 18:48545354-48545376 GAGCCAGGCGGCCATGGGACTGG + Intronic
1157557315 18:48621382-48621404 CAGCCAGGAGGCCAGGGTGCTGG + Intronic
1158303854 18:56083160-56083182 GAGCCAGGAGGCCAGGAGGCCGG + Intergenic
1158340633 18:56462169-56462191 GTGCCAGCTGGCCAGGCTGGAGG - Intergenic
1160427550 18:78788348-78788370 GTGGCAGCCGGCCAGAGAGCAGG - Intergenic
1160442678 18:78904297-78904319 GAAGCAGCTGGCCAGGGTCCCGG + Intergenic
1161001322 19:1912565-1912587 GAGCCGCCCAGCCAGGGCGCTGG - Exonic
1161119301 19:2516715-2516737 GTGACACCCGGCCAGGGGGCTGG + Intronic
1161299911 19:3537612-3537634 GAGCCAGGAGGCCGGGGGGCCGG + Intronic
1161400892 19:4065900-4065922 GGGCCAGCCCGCCAGGGGGCGGG - Intronic
1161658315 19:5529694-5529716 CAGCCAGCTGGCCAGGGAGGCGG + Intergenic
1162017267 19:7852368-7852390 GGGCCAGCTGGGCCGGGTGCAGG + Intronic
1162084528 19:8240536-8240558 CAGGCAGCGGGCCAGGCTGCAGG + Intronic
1163282241 19:16325026-16325048 GAGCCCGCCGCCCACGGTCCCGG - Intronic
1163437933 19:17306310-17306332 GAGCACGCCGGCCGGCGTGCAGG + Exonic
1163585173 19:18160024-18160046 GAGAAAGCCGGCCAGGATGGCGG - Intronic
1163614394 19:18318241-18318263 GAGCCACCCGGCCAGGGTTGAGG - Intronic
1163715202 19:18869192-18869214 GCGCAAGCGGGCCAGGGCGCGGG - Exonic
1164541745 19:29126678-29126700 CAGCCATCCACCCAGGGTGCTGG - Intergenic
1164594929 19:29526405-29526427 GGGCAAGCCGGCGAGGGAGCGGG + Intergenic
1164656018 19:29922616-29922638 GAGGCAGAAGGCCATGGTGCTGG - Intergenic
1165024742 19:32951950-32951972 TAACCAGCCGGCAAGTGTGCGGG + Intronic
1165351369 19:35277699-35277721 GAGCCACCCTGGCAGGGGGCTGG + Intronic
1166231458 19:41427564-41427586 GAGACAGCTGGGAAGGGTGCAGG + Exonic
1166393934 19:42425091-42425113 GAGGCAGCCTGGCAGGGAGCAGG + Intronic
1166569245 19:43783211-43783233 GAGCCGGGCGGCCAGTGGGCAGG - Intergenic
1166719379 19:44988482-44988504 CAGCCTGCCGGGCAGGGTGGCGG - Intronic
1166747570 19:45148691-45148713 GAGGCAGACGGCCAGCGGGCTGG - Intronic
1166855555 19:45781252-45781274 GGGCCAGAGGGGCAGGGTGCTGG + Intronic
1166871955 19:45876659-45876681 GAGCCAGCGCGGCAGGGGGCGGG - Intergenic
1167721418 19:51182749-51182771 GAGGCAACTGCCCAGGGTGCAGG + Intergenic
1167729232 19:51241125-51241147 GAGGCAACTGCCCAGGGTGCAGG + Intronic
1167752024 19:51387244-51387266 GAGCCCCCCGGCCAGGGTCCAGG - Exonic
1167763558 19:51464021-51464043 GAGGCAACTGCCCAGGGTGCAGG - Intergenic
1168125195 19:54278950-54278972 GGGGCTGCCGGCCAGGGAGCTGG + Exonic
1168133817 19:54337538-54337560 GGGGCTGCCGGCCAGGGCGCTGG + Exonic
925114300 2:1365567-1365589 GAGCCAGCGAGCCAGCCTGCCGG - Intronic
925165699 2:1714333-1714355 GAGCGAGTGGGCCAGGGTGCCGG - Intronic
925347079 2:3178914-3178936 GCGCCAGCCAGGCAGGGAGCTGG - Intergenic
926196653 2:10768220-10768242 GAGCCAGTCGGCCAGAAAGCAGG + Intronic
926219690 2:10926370-10926392 CATCCAGGCGGCCAGGGCGCAGG - Intergenic
926222445 2:10945016-10945038 AAGCCAGCCCCCCAGGGTGCAGG + Intergenic
926423918 2:12724281-12724303 GAGACAGCTGGACAGGATGCAGG + Intronic
927863742 2:26576084-26576106 CAGCCAGCGGTCCCGGGTGCTGG - Exonic
931463568 2:62468205-62468227 GAGCCAGCCAGTAAGGCTGCTGG - Intergenic
931614790 2:64144576-64144598 GAGCGAGCCTGGTAGGGTGCTGG - Intergenic
932707514 2:74038130-74038152 GAGCTAGCCAGGCGGGGTGCAGG + Intronic
934300236 2:91772529-91772551 GAGGCATCCGCACAGGGTGCAGG - Intergenic
934516162 2:94988101-94988123 GACACAGACGGCCAGGCTGCTGG + Intergenic
934775451 2:96934325-96934347 GAGCAAGGAGCCCAGGGTGCTGG + Intronic
935785804 2:106547668-106547690 GAGCTAGTCTGCCATGGTGCTGG - Intergenic
936985606 2:118309347-118309369 GAGGCAACAGGCCAGGGTGGGGG + Intergenic
938066758 2:128285666-128285688 GAGTCAGCCTGGCAGGGTGGAGG - Intronic
938093302 2:128447153-128447175 GAGCCACCTGGCCAGGGGCCGGG - Intergenic
938307014 2:130263458-130263480 GAGCCACCTGGCCAGGCTGTTGG + Intergenic
940991241 2:160098824-160098846 GGGCCAGAAGTCCAGGGTGCAGG + Intergenic
945241572 2:207681514-207681536 GAGCCAGCCGGCGGGCGTCCCGG + Intergenic
947911995 2:233807701-233807723 GACCCAGCCAGCCAGGGTGAGGG - Intronic
948731020 2:239963764-239963786 GAGCCGACCATCCAGGGTGCTGG + Intronic
949004258 2:241636723-241636745 GACCCAGGCGGCCGGGGTGGGGG + Intronic
949050404 2:241894797-241894819 CAGGCAGCCGGGCAGGGTGCAGG - Intronic
1170713338 20:18811191-18811213 GAAGCAGCCTGCCACGGTGCAGG + Intronic
1171346613 20:24470236-24470258 GAGCCGGGCGGCCACGGAGCTGG + Intronic
1173617496 20:44412692-44412714 GAGACAGCGGGCCTGGGAGCAGG + Intronic
1173671672 20:44803457-44803479 AAGGCAGCTGGCCAGGGTCCTGG + Intronic
1173851360 20:46220435-46220457 CAGCCACCAGGCCAGGGAGCAGG + Intronic
1173927512 20:46791955-46791977 GAGGCTGCTGGCCAGTGTGCAGG - Intergenic
1174917543 20:54669233-54669255 GAGCCAGCCTGCCTGGGTTTGGG + Intergenic
1175084295 20:56445758-56445780 GAGCCTGCCAGCGGGGGTGCCGG + Intronic
1175217325 20:57398452-57398474 GAGCCAGGCGGCATGGGGGCTGG + Intronic
1175813576 20:61872136-61872158 GTGCCAGAAGCCCAGGGTGCGGG - Intronic
1175891870 20:62319288-62319310 GAGAGAGCTGGCCAGGGAGCAGG - Intronic
1175971151 20:62687397-62687419 GAGCCAGCAGGCCAAGGAGGCGG + Intergenic
1176086764 20:63298949-63298971 GAGGCGGCCGTCCAGGGAGCAGG - Intronic
1176097264 20:63349888-63349910 GAGGCAGATGGCCAGGCTGCCGG - Exonic
1176178052 20:63737857-63737879 GAGGCAGCGGGCGAGGCTGCAGG + Exonic
1177826466 21:26089918-26089940 GAGCCGGCCGGCCGTGGGGCTGG - Intronic
1178939840 21:36896098-36896120 GAGTCAGCCTCCCAGAGTGCTGG - Intronic
1179114265 21:38475664-38475686 GAGCCAGGTGGCCGGGGGGCGGG - Intronic
1180801500 22:18634112-18634134 GAGCCAGCCGGCCCGGGGCTCGG - Intergenic
1180910869 22:19448984-19449006 AAGGCTGCAGGCCAGGGTGCAGG + Intergenic
1181102597 22:20551348-20551370 GTGCCAGCAGGCGAGGGGGCGGG + Intronic
1181220222 22:21361149-21361171 GAGCCAGCCGGCCCGGGGCTCGG + Intergenic
1183434330 22:37784591-37784613 GAGCCAGAAGGCCAGGGGACAGG + Intergenic
1184849919 22:47114227-47114249 AAGCCACACGGCCAGGGTGTGGG + Intronic
1184880193 22:47299689-47299711 GAACCAGGCGGCCAAGCTGCAGG + Intergenic
1184922398 22:47614751-47614773 GAGCGAGCCGGGCAGGGGGCAGG + Intergenic
1184946752 22:47809215-47809237 GAGGCAGCCGGACAGTGGGCAGG - Intergenic
1185105513 22:48867359-48867381 GAGCCAGCTGGGCAGCATGCCGG - Intergenic
1185334133 22:50263958-50263980 TAGAGAGCGGGCCAGGGTGCAGG + Exonic
949508879 3:4751381-4751403 CACCAGGCCGGCCAGGGTGCAGG - Intronic
950107041 3:10394855-10394877 GAGCCAGGGGGCCAGGATGGCGG - Intronic
950172785 3:10851106-10851128 GAGCCAGCTGGGGAGGGTGTAGG - Intronic
950431299 3:12952667-12952689 CAGCCAGGAGGCCAGGGGGCTGG - Intronic
951531391 3:23701714-23701736 CAGACAGCCTGCCAGGGTCCAGG - Intergenic
952952878 3:38538764-38538786 GTCCCAAGCGGCCAGGGTGCAGG - Intronic
953307626 3:41844443-41844465 GGGCCAGCCGGCCTGAGTGCAGG + Intronic
953385050 3:42501692-42501714 AAGGCAGGCGGCCAGGGTCCTGG + Intronic
953387281 3:42513751-42513773 CGGCCAGGCGGCCAGGCTGCAGG + Exonic
953660590 3:44888780-44888802 GAACCAGCCTTCCAGGGTGCAGG - Intronic
954149555 3:48650602-48650624 GAGCCAGGCAGTCAGGGTACAGG + Intronic
956009775 3:64818183-64818205 AGGCCAGCCTCCCAGGGTGCTGG - Intergenic
957382488 3:79450312-79450334 GAGACAGACAGACAGGGTGCTGG + Intronic
958697038 3:97540973-97540995 GAACCAACCTGCCAGGCTGCAGG + Intronic
958787460 3:98613256-98613278 TAGCCAGGCGGCCAGTGAGCAGG + Intergenic
958988806 3:100816628-100816650 GGGACAGCCTGCCAGGGTTCAGG + Intronic
961042717 3:123688694-123688716 GAGGCAGGAGGCCAGGGTGGTGG - Intronic
961154475 3:124667119-124667141 CATCCAGCAGGCCTGGGTGCAGG + Intronic
961438587 3:126936949-126936971 GAGGCAGCAGGCCAGGGTGAAGG - Intronic
961750419 3:129091000-129091022 GAGCCAGCCCTCCTGGGTACCGG - Exonic
962265884 3:133944012-133944034 CACCCAGCTGGCCAGGGAGCAGG - Intronic
964431058 3:156606241-156606263 GAGCCAGCCGGCCGGCCGGCCGG + Intergenic
964693879 3:159485232-159485254 GAGCCAGCCTGCCTGGGGTCAGG + Intronic
967938770 3:194750042-194750064 GTACCAGCCGTCCAGGGCGCTGG - Intergenic
968548305 4:1209852-1209874 GAGCCTGGCGGCCAGGGAGCCGG - Intergenic
968625774 4:1626046-1626068 GTGGCTGCCTGCCAGGGTGCAGG + Intronic
968650972 4:1760171-1760193 GAGCCAGCTGGGGTGGGTGCAGG - Intergenic
968830329 4:2930333-2930355 GGGACATCCTGCCAGGGTGCGGG + Intergenic
969040341 4:4290570-4290592 GACCCAGACGGCCAGGTTCCGGG + Intronic
969329260 4:6463589-6463611 TTGCCAGCCGGCCCGGGAGCAGG - Intronic
969379354 4:6783522-6783544 GAGCGAGCGGCCCAGGCTGCCGG - Intronic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
975478178 4:74846541-74846563 GAGCAAGGAGGCCAGGTTGCTGG - Intergenic
977727529 4:100314229-100314251 GAGTCAGCCTCCCAGGGAGCAGG - Intergenic
978503582 4:109433957-109433979 GCGCCCGCGGGCCCGGGTGCGGG + Exonic
978754304 4:112286014-112286036 GAGAGAGGCGGCCAGGGGGCTGG - Intronic
985871142 5:2557582-2557604 GAGTCAGGGGGCCAGGATGCAGG + Intergenic
992074929 5:73183701-73183723 GAACCAGGGGGCCAGGGGGCAGG - Intergenic
992564806 5:77986527-77986549 GGGCCAGCAGGTCAGGGTGTGGG + Intergenic
997201358 5:132011777-132011799 GACCCGGCCGGCCAGGCTGCAGG - Intronic
997465799 5:134087347-134087369 GAGCCAGGAGGCCTGGGTGCTGG + Intergenic
997517799 5:134503321-134503343 GAGCCAGCTGGCCAGGGTTCAGG + Intergenic
998128158 5:139637935-139637957 GCCCCAGCCGGCCGGTGTGCTGG + Intergenic
999307003 5:150525973-150525995 GAGCCAGGCCTGCAGGGTGCTGG - Intronic
1001229216 5:169971284-169971306 GAGCCAGCCTGCCGGGGAGCTGG + Intronic
1003328742 6:5112137-5112159 GAGCGTGCCGCCCAGGCTGCAGG - Intronic
1003463523 6:6354297-6354319 GAGTGAGCTGGACAGGGTGCTGG - Intergenic
1003966652 6:11258327-11258349 GAGCCAGCCAGCCAGGGTGCTGG - Intronic
1005991696 6:30907171-30907193 GAGCCACCTCGCCAGGCTGCAGG + Intergenic
1006393310 6:33771594-33771616 GAGCCTGCCTCCCAGGGAGCAGG + Exonic
1006402650 6:33826778-33826800 GAGCCAGGCAGCCTGGGTGGAGG - Intergenic
1007078807 6:39084606-39084628 GACTCAGCCGGGCAGGGAGCTGG + Intronic
1007618980 6:43200131-43200153 AATGCAGCCGGCCAGGATGCTGG - Exonic
1010294798 6:74183139-74183161 CAGCCAGCCGCTCTGGGTGCTGG - Intergenic
1013094775 6:106934699-106934721 GAGCCAGCCTCCCAAAGTGCTGG - Intergenic
1013288505 6:108700068-108700090 GAGCCAGGCTGCGAGGGTGGTGG - Intergenic
1017502891 6:155041951-155041973 GAGCCAGCCTGCCAGAGTGAGGG - Intronic
1017884416 6:158587223-158587245 GGGCCAGGCTGCCAGGGTACTGG + Intronic
1018847788 6:167567210-167567232 GAGCCAGCCAGACAGGGTGCTGG + Intergenic
1019195538 6:170280307-170280329 GAACCAGGCTGCCAGGGCGCTGG + Intergenic
1019347402 7:537791-537813 GGGCCAGCCTGCCAGGGACCTGG + Intergenic
1019742773 7:2682979-2683001 AGGCCAGCAGGCGAGGGTGCAGG - Intronic
1020649247 7:10855001-10855023 AAGCCAGGGGGCCAGGCTGCCGG + Intergenic
1022605861 7:31813338-31813360 GAAGCAGCCTGCCAGGGTGCTGG + Intronic
1023833810 7:44056978-44057000 GGCCCAGCCAGCCCGGGTGCTGG - Intronic
1026677323 7:72438659-72438681 GAGGCAGCCAGCCAGGTTCCTGG - Intronic
1026822392 7:73558015-73558037 GAGCCAGAGGGCAAAGGTGCTGG - Intergenic
1026864571 7:73815488-73815510 AAGCCAGACGTACAGGGTGCTGG + Intronic
1027139063 7:75644207-75644229 GAGCCAGCCACCCACTGTGCTGG - Intronic
1029609399 7:101618694-101618716 GAGCCGGGAGGGCAGGGTGCTGG - Intronic
1029625086 7:101715815-101715837 TAGTCAGCAGGCCAGGGTCCGGG - Intergenic
1029791418 7:102846813-102846835 CAGCCAGCCCACCAGGCTGCAGG + Intronic
1032076141 7:128837102-128837124 CAGCCAGCCGGCCAGGATGCAGG - Intronic
1032419332 7:131765239-131765261 GAGTCAGCAGGGCAGGGTTCTGG + Intergenic
1033246524 7:139721059-139721081 GAGGCAGCCGGCTGTGGTGCAGG - Intronic
1033253682 7:139780791-139780813 GAGTCAGCCATCTAGGGTGCGGG - Exonic
1034418999 7:150979243-150979265 GAGCCAGCTGGCCGGGGGGAGGG - Intergenic
1034513334 7:151553697-151553719 GAGCTAGGGGGCCTGGGTGCAGG + Intergenic
1035061519 7:156073008-156073030 GAGTCAGCCAGCCTGGCTGCTGG + Intergenic
1035578497 8:724877-724899 GGGCCAGGCGGCGTGGGTGCAGG - Intronic
1035694711 8:1586380-1586402 GAGCCAGCTGGACGGGGTGTGGG + Intronic
1037336877 8:17800978-17801000 GAGCGCGCCGCCCAGGGTGACGG - Intergenic
1037568745 8:20140925-20140947 GGGGCAGCCGACCATGGTGCAGG - Intergenic
1037768958 8:21787984-21788006 GAGCTAGCCGGGCCCGGTGCTGG - Intronic
1038421662 8:27437693-27437715 GAGCCAGGGGACCAGGGTGCTGG - Intronic
1039557145 8:38484733-38484755 AAGCCAGCCAGCCAGGCTGTAGG + Intergenic
1041133052 8:54723046-54723068 GAGCCAGACTGCCAGTGTCCAGG + Intergenic
1041380299 8:57247915-57247937 ATGCCAGGCTGCCAGGGTGCAGG - Intergenic
1046743102 8:117848946-117848968 GACCCAGTCGGCCAAGGTGTAGG - Intronic
1048379820 8:133855530-133855552 AAGGCAGCTGGCAAGGGTGCTGG + Intergenic
1049192847 8:141298369-141298391 CAGCCATCTGGCCAGGGTGATGG - Intronic
1049531634 8:143158292-143158314 GAGCCCCCCGGCCAGGGCCCAGG + Exonic
1049569146 8:143360172-143360194 GAGGCGGCCGGCCGGGGTGGAGG + Intergenic
1049721024 8:144115619-144115641 GAGCAGGCCCGGCAGGGTGCAGG - Exonic
1051170586 9:14315422-14315444 GAGCCAGCCAGCGGGGCTGCAGG - Intronic
1052341203 9:27366037-27366059 GAGGAGGCAGGCCAGGGTGCTGG + Intronic
1053093710 9:35305465-35305487 GAGCTAGCTAGCCAGGGTGCTGG + Intronic
1057533558 9:95876023-95876045 GATCCATCCGGCCAGGGGGAGGG - Exonic
1060757235 9:126222899-126222921 GAGCCAGCGGGGTAGGGGGCGGG - Intergenic
1061181873 9:129029263-129029285 GAGGCAGCAGGCCTGGGTGGTGG - Intergenic
1061287521 9:129632607-129632629 GAGTCAGCGGGCCAGGGACCTGG - Intronic
1061432644 9:130540955-130540977 GAGACACCCAGCCAGGGTGATGG + Intergenic
1061844600 9:133379945-133379967 CAGCCAGCCAGCAAGGGAGCAGG - Intronic
1061872198 9:133527038-133527060 GAGCCAGCCGGCCAGAGCCCTGG - Intronic
1061934081 9:133847597-133847619 GAGTCAGGGGGCCAGGGTTCCGG - Intronic
1062136792 9:134933381-134933403 GAGCCAGCGGGGCAGGGTGGGGG - Intergenic
1062201581 9:135305738-135305760 GAGCCAGGCTGCCAAGGAGCAGG - Intergenic
1062279350 9:135745005-135745027 GAGCCCGCCTCCCAGGGTGGGGG + Intronic
1062626617 9:137445926-137445948 GAGACCTCCCGCCAGGGTGCAGG - Intergenic
1185745864 X:2572947-2572969 GAGTCAGACGGCCAGGAAGCTGG + Intergenic
1186578361 X:10790438-10790460 GAGCCAAGCAGCAAGGGTGCTGG - Intronic
1189299116 X:39939667-39939689 GAGCCCTACGGCCAGGCTGCAGG - Intergenic
1189809052 X:44764063-44764085 GCGCCAGCCTCCCAGAGTGCTGG + Intergenic
1189853583 X:45200772-45200794 GGGCCAGCCAGCCAGGGCGGAGG + Exonic
1190745329 X:53319095-53319117 GAGGCAGCAGGCTGGGGTGCTGG - Intronic
1192220937 X:69196885-69196907 GAGCCAACCGTGCAGGGGGCTGG + Intergenic
1198099875 X:133414629-133414651 GAGCCAGGCAGCCCGGGCGCAGG - Intronic
1199981462 X:152922858-152922880 GAACCAGCCAGCCAGGCTGGCGG - Intronic
1200002179 X:153067681-153067703 GCTCCAGCCTGCCAGGGTACCGG - Intergenic
1200005554 X:153082344-153082366 GCTCCAGCCTGCCAGGGTACCGG + Intergenic
1200058534 X:153473897-153473919 GAGCCTGCATGCCAGGATGCAGG - Intronic
1202368215 Y:24180901-24180923 GTGCCGGCCGGTGAGGGTGCTGG - Intergenic
1202372482 Y:24208281-24208303 GTGCCGGCCGGTGAGGGTGCTGG + Intergenic
1202498303 Y:25461839-25461861 GTGCCGGCCGGTGAGGGTGCTGG - Intergenic
1202502570 Y:25489216-25489238 GTGCCGGCCGGTGAGGGTGCTGG + Intergenic