ID: 1083674130

View in Genome Browser
Species Human (GRCh38)
Location 11:64316118-64316140
Sequence CCCCCTAGGAGGGGGAGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 446}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083674130_1083674140 5 Left 1083674130 11:64316118-64316140 CCTCTCCTCCCCCTCCTAGGGGG 0: 1
1: 0
2: 2
3: 42
4: 446
Right 1083674140 11:64316146-64316168 GAAGCTGGGAACGTGTGTCCAGG 0: 1
1: 2
2: 0
3: 6
4: 160
1083674130_1083674137 -10 Left 1083674130 11:64316118-64316140 CCTCTCCTCCCCCTCCTAGGGGG 0: 1
1: 0
2: 2
3: 42
4: 446
Right 1083674137 11:64316131-64316153 TCCTAGGGGGTGTCAGAAGCTGG 0: 1
1: 2
2: 0
3: 5
4: 148
1083674130_1083674139 -9 Left 1083674130 11:64316118-64316140 CCTCTCCTCCCCCTCCTAGGGGG 0: 1
1: 0
2: 2
3: 42
4: 446
Right 1083674139 11:64316132-64316154 CCTAGGGGGTGTCAGAAGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 135
1083674130_1083674141 11 Left 1083674130 11:64316118-64316140 CCTCTCCTCCCCCTCCTAGGGGG 0: 1
1: 0
2: 2
3: 42
4: 446
Right 1083674141 11:64316152-64316174 GGGAACGTGTGTCCAGGCTCTGG 0: 1
1: 0
2: 4
3: 11
4: 132
1083674130_1083674142 12 Left 1083674130 11:64316118-64316140 CCTCTCCTCCCCCTCCTAGGGGG 0: 1
1: 0
2: 2
3: 42
4: 446
Right 1083674142 11:64316153-64316175 GGAACGTGTGTCCAGGCTCTGGG 0: 1
1: 0
2: 4
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083674130 Original CRISPR CCCCCTAGGAGGGGGAGGAG AGG (reversed) Exonic
901857499 1:12053680-12053702 CCCCCCAGGAGGTGGATGTGGGG + Intergenic
902053738 1:13583777-13583799 CTCCCGAGGAGGCGGGGGAGCGG - Exonic
902330115 1:15727184-15727206 CCCCCCAGGAGGAGGGAGAGGGG + Exonic
902520219 1:17011644-17011666 ACCCCTTGGAGGGAGAGGGGAGG - Intronic
902627768 1:17686690-17686712 CCCACAAGGAAGGGCAGGAGTGG + Intronic
903185475 1:21626527-21626549 CCCAAGAGGAGGGAGAGGAGGGG + Intronic
903277813 1:22232938-22232960 AGCCCATGGAGGGGGAGGAGAGG - Intergenic
904014577 1:27409828-27409850 CCCCGGAGGAGGAGGAGGAGGGG + Exonic
904038619 1:27571722-27571744 CAGCCTGGGAGGGGGAGGGGAGG - Intronic
904808971 1:33151117-33151139 CACCCTAGGAGGGAGACAAGGGG + Intronic
905202582 1:36324037-36324059 CCTCCTAGGAGGGGGAGCGGTGG - Exonic
905725249 1:40245820-40245842 CCTCCAAGCTGGGGGAGGAGGGG + Intergenic
905886156 1:41493285-41493307 TCCCCTAGGAGGAGGAGGTTTGG + Intergenic
906145487 1:43557986-43558008 CCTCCTAGGAGGGAGGGGAGGGG - Intronic
906288337 1:44602977-44602999 GGCCCGAGGAGGAGGAGGAGGGG - Intronic
906312424 1:44763389-44763411 CACTCCAGGAAGGGGAGGAGAGG - Intronic
906785503 1:48611998-48612020 GGCCCTAGGAAGTGGAGGAGAGG + Intronic
906821969 1:48939515-48939537 GCCTCCAGGAGGGGGAGGAAAGG + Intronic
907526917 1:55059122-55059144 CCAGCTAGGAGAGTGAGGAGGGG + Intronic
908477640 1:64505546-64505568 CCCCAGAGGAGGGGGCGGGGCGG - Intronic
908477673 1:64505618-64505640 CGCCCAGGGAGGGGGAGGAACGG - Intronic
908892590 1:68863321-68863343 CCCCCTAGGAGGTTGAGCAGTGG - Intergenic
910757978 1:90711158-90711180 ACCCCTAGAAGAAGGAGGAGGGG + Intergenic
911184033 1:94885984-94886006 CCACCGAGGTGGGGGTGGAGGGG + Intronic
912521808 1:110250800-110250822 TTCTCTAGGAGGAGGAGGAGAGG + Intronic
913075428 1:115337695-115337717 CCCCCAGGTAGGGGGAGGAGCGG - Intronic
914930299 1:151925234-151925256 CTGCCTAGGAAGGGTAGGAGGGG + Intergenic
915099862 1:153491362-153491384 GCCCTTAGCAGTGGGAGGAGAGG - Intergenic
915590214 1:156866424-156866446 CCCGGAAGGAGGAGGAGGAGGGG + Intronic
916108653 1:161447944-161447966 CCCGGTGGGAGGCGGAGGAGTGG - Intergenic
916110241 1:161455325-161455347 CCCGGTGGGAGGCGGAGGAGTGG - Intergenic
916111826 1:161462735-161462757 CCCGGTGGGAGGCGGAGGAGTGG - Intergenic
916113413 1:161470116-161470138 CCCGGTGGGAGGCGGAGGAGTGG - Intergenic
917483227 1:175431495-175431517 CCCCATAGAAGGGAGAGAAGAGG - Intronic
918140342 1:181714528-181714550 CTCCCTAGAAGTGGGAGTAGGGG + Intronic
920038595 1:203081817-203081839 CCCCCTTGGAGGGGCTGGAGAGG - Intergenic
922467440 1:225853829-225853851 CGCTCTTGGAGGGAGAGGAGGGG + Intronic
922651643 1:227345032-227345054 CCCCCTGGGATGGGGTGCAGTGG - Intergenic
924934780 1:248758634-248758656 ACCTCTGGGAGAGGGAGGAGTGG - Intergenic
1063668883 10:8083732-8083754 CCACAAAGGAGGGGAAGGAGAGG + Intergenic
1064086451 10:12349451-12349473 GCCCGCGGGAGGGGGAGGAGGGG + Intergenic
1064251147 10:13707435-13707457 CCTTCCAGGAGAGGGAGGAGAGG + Intronic
1065371560 10:24991949-24991971 CCCCCTAGAAGTGTGAGCAGTGG + Intronic
1066265823 10:33774759-33774781 CCCCCTGTGAGGGGGACAAGGGG + Intergenic
1066370395 10:34814787-34814809 CTTCCTGGAAGGGGGAGGAGAGG - Intronic
1067058816 10:43067431-43067453 GCCCCTAGGAGAAGAAGGAGGGG + Intergenic
1067286086 10:44908563-44908585 CCCCGGAGGAGGGGGAGGTCTGG - Intergenic
1067315789 10:45160851-45160873 CCTCCTAGGAGGTTGAGGGGTGG - Intergenic
1068036540 10:51766606-51766628 CCCCATAGGAGTAGGAGAAGAGG - Intronic
1069631080 10:69897362-69897384 TCCCCAGGGAGGGAGAGGAGAGG + Intronic
1070742307 10:78911139-78911161 CCCACTAGGAGTGAGAGGACAGG - Intergenic
1070754816 10:78985474-78985496 CCCCCTAGGACGCCGAGGATAGG + Intergenic
1071291629 10:84193477-84193499 GCCCCTGGCAGGGGGAGGGGGGG + Intergenic
1071531291 10:86391983-86392005 GCCCCCAGGAGAGGGAGCAGAGG + Intergenic
1072503839 10:96044284-96044306 CCCCCGGGGAGGGGGCGCAGAGG + Intronic
1073084551 10:100879861-100879883 GCCACCAGGAGGGGGAGGGGTGG - Intergenic
1073100794 10:101005657-101005679 CCACCTTGGAGCGGGAGCAGCGG + Exonic
1073326714 10:102647523-102647545 CCTCCCAGGAGGGAGAGGAGGGG + Intronic
1073381033 10:103078299-103078321 CTCCCTGGGAGGAGGAGCAGGGG - Exonic
1074801492 10:117005204-117005226 CGCGCCAGGAGGAGGAGGAGCGG - Exonic
1075648849 10:124114514-124114536 CCTCCTTGAAGGAGGAGGAGGGG + Intergenic
1076164046 10:128267977-128267999 CCACCCAGGAGGGGGTGGTGGGG + Intergenic
1076571133 10:131433765-131433787 CCGCCAAGGAGGGAGACGAGAGG + Intergenic
1076784710 10:132744054-132744076 CCCCCACAGAGGTGGAGGAGTGG + Intronic
1076890098 10:133279162-133279184 CTCCCACGGAGGGGGAGGTGTGG + Exonic
1077147405 11:1052338-1052360 TGCCCCAGGAGGGGGAGGGGAGG - Intergenic
1077152121 11:1077163-1077185 GCCCCGAGGAGGGAGTGGAGAGG + Intergenic
1077206460 11:1346885-1346907 CCCCTGAGGTGGGTGAGGAGGGG + Intergenic
1077406631 11:2385343-2385365 TGCCCTGGGACGGGGAGGAGGGG - Intronic
1077482488 11:2822399-2822421 CCCTCTAGGAGGTGGAGGTGGGG + Intronic
1077601959 11:3580633-3580655 GCCCCTAGCAGGGGAAGGGGCGG - Intergenic
1077714900 11:4570765-4570787 CCCCCTAGGGGAAGGAGTAGGGG - Intergenic
1077809638 11:5624414-5624436 CCCGCTAGGAGATGGAGGATGGG - Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1079128693 11:17735488-17735510 GCCCCCAGGAGGGGGAGGGGAGG - Exonic
1080034836 11:27700307-27700329 CCCCCGAGCAGGAGGTGGAGGGG + Intronic
1081419201 11:42852888-42852910 CCTGCTAGGAGAGGAAGGAGAGG - Intergenic
1081976732 11:47240079-47240101 TCCCCTAGGAGGTGGAGGGAAGG + Exonic
1083276470 11:61599807-61599829 CCTCCTCTGAGGGGCAGGAGGGG + Intergenic
1083384911 11:62300462-62300484 CCACCAAGGAGGGGGAGGGTTGG + Intergenic
1083674130 11:64316118-64316140 CCCCCTAGGAGGGGGAGGAGAGG - Exonic
1083904767 11:65662590-65662612 CTCCCTGGGTGGGGGAGCAGAGG - Intronic
1083933856 11:65860357-65860379 CCCCCTGTGACGGGGAGGACTGG - Intronic
1084165950 11:67374761-67374783 AGCCCTTGGAGAGGGAGGAGGGG - Intronic
1084257868 11:67955179-67955201 GCCCCTAGCAGGGGAAGGGGCGG - Intergenic
1084881290 11:72173288-72173310 CCCACAAGGAAGGGGAGGGGAGG + Intergenic
1084907313 11:72358041-72358063 CTCCCAAGGAGAGGCAGGAGTGG + Intronic
1085173920 11:74470579-74470601 CCCCAGAGAAGGGGGAGTAGAGG - Intergenic
1085321097 11:75574562-75574584 CCACATAGGAAGGGCAGGAGAGG + Intergenic
1088058036 11:105609820-105609842 CATCCTGGGAAGGGGAGGAGGGG - Intergenic
1088764302 11:112961710-112961732 CCTCCTAGGAGTAGGAGGAAGGG - Intronic
1089132729 11:116224933-116224955 CCCCGCAGGAGGGGGAGAAAAGG + Intergenic
1089399290 11:118155179-118155201 GCCCAGAGCAGGGGGAGGAGAGG + Intergenic
1089586579 11:119513357-119513379 CCCCCTCAGTCGGGGAGGAGTGG - Intergenic
1090457093 11:126859513-126859535 GCCAATAGGAGGAGGAGGAGGGG + Intronic
1091298524 11:134490009-134490031 CTCCCAAGGCGGGGTAGGAGGGG - Intergenic
1091440547 12:509230-509252 CCGCCTAGGAGGGGATGGATGGG + Intronic
1092265280 12:6976265-6976287 CCCCCCATGGGGGGGTGGAGAGG - Exonic
1092831599 12:12449331-12449353 CTCCCAAGGAACGGGAGGAGTGG + Intronic
1092916754 12:13196382-13196404 CAGCCTGGGAGGGGGAGGAAAGG - Intergenic
1093712941 12:22348359-22348381 CCCCCTAGGAGTCTGAGTAGCGG + Intronic
1094479326 12:30869315-30869337 CCCTCTAGGTTGAGGAGGAGAGG + Intergenic
1094525163 12:31226586-31226608 TGCCCTAGGAGGGGAAGGGGAGG + Intergenic
1096229506 12:49889324-49889346 CACCTGATGAGGGGGAGGAGGGG - Intronic
1096650330 12:53059270-53059292 CCTCCTAGGAGGCTGCGGAGTGG + Exonic
1096782095 12:53997437-53997459 TCTCCTGGGAGGGGCAGGAGAGG + Intronic
1096863796 12:54549469-54549491 TCCTTTGGGAGGGGGAGGAGTGG + Exonic
1097175919 12:57142914-57142936 TCTCCTAGGTGGGGGTGGAGTGG + Intronic
1098294115 12:68986656-68986678 CCCCCTAGGTTGGGGTGCAGTGG + Intergenic
1100368535 12:93943736-93943758 GCCCTTATGATGGGGAGGAGAGG + Intergenic
1102041511 12:109803971-109803993 GCCCCTAGAAGGGAGTGGAGGGG + Intronic
1102461102 12:113100065-113100087 GCCCCTAGGAGGGAGACAAGAGG + Exonic
1102503487 12:113369098-113369120 CCCACCTGGAGGGGAAGGAGGGG - Exonic
1102508278 12:113397653-113397675 CCCCCTGGGAGAAGGAGCAGGGG - Intronic
1103036639 12:117662285-117662307 CCCCAGAAGAGAGGGAGGAGAGG - Intronic
1103074049 12:117968277-117968299 CTCTCTGGGAGGAGGAGGAGGGG - Intronic
1103330861 12:120153212-120153234 CCTGCTGGGAGGGGGTGGAGAGG + Exonic
1104088231 12:125494313-125494335 CCAGTGAGGAGGGGGAGGAGGGG - Intronic
1104088404 12:125494827-125494849 CCAGGGAGGAGGGGGAGGAGGGG - Intronic
1104088418 12:125494861-125494883 CCAGGGAGGAGGGGGAGGAGGGG - Intronic
1104477818 12:129084808-129084830 CCCCATAGTAAGGGGAGGAAAGG - Intronic
1104618638 12:130292583-130292605 CACCCTAGGCTGGGGAGCAGGGG + Intergenic
1105293849 13:19071631-19071653 CAGCCTTGGCGGGGGAGGAGGGG - Intergenic
1106227664 13:27797129-27797151 ACTCCTAGGCGGGAGAGGAGGGG - Intergenic
1108243539 13:48492304-48492326 CCCCTTAGTAGGTGGAGCAGTGG - Intronic
1108594175 13:51935989-51936011 ACCACAAGGAGTGGGAGGAGCGG + Intronic
1109499066 13:63214033-63214055 CCCCCTAGAAGGTGGAGAAGGGG - Intergenic
1110119600 13:71865773-71865795 GCCCCGAGCAGGGAGAGGAGAGG + Intronic
1110410414 13:75198727-75198749 CCCCCTAGAAAGGGGTGGTGGGG - Intergenic
1112016698 13:95337178-95337200 CTCCCAAGGATAGGGAGGAGAGG - Intergenic
1112405921 13:99120130-99120152 CCCCCTAGGCTGGAGAGCAGTGG + Intergenic
1112552380 13:100433787-100433809 ACCCTTATGATGGGGAGGAGTGG - Intronic
1112797047 13:103068339-103068361 ACACCTAGGAGTGGGAGGGGAGG - Intergenic
1113539193 13:111093407-111093429 CCCCCATGGAGGGAGAGGAGGGG + Intergenic
1113571819 13:111363307-111363329 CCCCCTATGAGGAGGAGGACAGG + Intergenic
1114056128 14:18968061-18968083 CCCTCCTGGCGGGGGAGGAGGGG + Intronic
1114106423 14:19433692-19433714 CCCTCCTGGCGGGGGAGGAGGGG - Intronic
1114450652 14:22822810-22822832 CCTCCTCGGAGCCGGAGGAGGGG + Intronic
1117943075 14:60989765-60989787 CCTGATAGGAGTGGGAGGAGAGG - Intronic
1118485211 14:66208110-66208132 TCCCTTAGGAGGGGCTGGAGAGG - Intergenic
1119254409 14:73184398-73184420 CCCCGTCGGAGAGGGAGGTGGGG - Intronic
1119379274 14:74218363-74218385 GCCCCAAGGTGGGGGTGGAGGGG + Intergenic
1121272176 14:92645128-92645150 CCCGCTAGTCGGGGGAGCAGGGG - Intronic
1121426614 14:93856708-93856730 TCCCTGAGGAGGGGAAGGAGGGG + Intergenic
1122745468 14:103894836-103894858 CCCCCAGGGTGGGGGTGGAGAGG + Intergenic
1122801595 14:104233032-104233054 CTCCCCAGGAGTAGGAGGAGGGG + Intergenic
1122825781 14:104369750-104369772 CGCCCTCGAAGGGGCAGGAGGGG + Intergenic
1123014508 14:105367393-105367415 CCCCACAGCAGGGGCAGGAGCGG - Intronic
1126692350 15:51297503-51297525 CCCTCTTGGAGGGGAATGAGAGG - Intronic
1128346376 15:66854905-66854927 CCCAGAAGGAGGGGGAGGTGTGG - Intergenic
1128492440 15:68162445-68162467 AACTCTAGGAGGGGAAGGAGAGG + Intronic
1129034673 15:72641983-72642005 GCCCCTATGAGGGGGATGAGAGG - Intergenic
1129215209 15:74095233-74095255 GCCCCTATGAGGGGGATGAGAGG + Intergenic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1129351269 15:74957149-74957171 TCCCCGGGGCGGGGGAGGAGGGG - Exonic
1129387713 15:75204974-75204996 CTCCTGCGGAGGGGGAGGAGTGG + Intronic
1129732358 15:77939578-77939600 GCCCCTATGAGGGGCATGAGGGG + Intergenic
1131306731 15:91251797-91251819 CCTGCAATGAGGGGGAGGAGAGG - Exonic
1131944335 15:97602806-97602828 GCCCATAGCAGGGGGAGGAAAGG + Intergenic
1132178368 15:99733220-99733242 CCCCCTAGGAGCCCGGGGAGGGG + Intronic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1132715193 16:1286567-1286589 CCCCCTAGGAGGGGAGAGACAGG + Intergenic
1133316334 16:4886292-4886314 CGCCCTAGGACGGGGACCAGAGG - Intronic
1134066714 16:11233113-11233135 CCCCCATGAAGAGGGAGGAGGGG - Intergenic
1135024622 16:18989555-18989577 CACCCTTGGAGGAGGAGGAAGGG + Intronic
1135315451 16:21441002-21441024 CACCCTTGGAGGAGGAGGAAAGG - Intronic
1135368377 16:21873270-21873292 CACCCTTGGAGGAGGAGGAAAGG - Intronic
1135443440 16:22497879-22497901 CACCCTTGGAGGAGGAGGAAAGG + Intronic
1135449238 16:22543344-22543366 CACCCTTGGAGGAGGAGGAAAGG + Intergenic
1135453305 16:22576444-22576466 CCCCCAAAGAGGAGGAGGGGTGG - Intergenic
1135821555 16:25691123-25691145 TCCCCCAGGAGAGGGAGGTGAGG + Intergenic
1136312121 16:29419661-29419683 CACCCTTGGAGGAGGAGGAAAGG - Intergenic
1136325560 16:29521458-29521480 CACCCTTGGAGGAGGAGGAAAGG - Intergenic
1136392527 16:29974431-29974453 CCCTCGACGAGGGGGAGGACTGG + Exonic
1136440249 16:30261440-30261462 CACCCTTGGAGGAGGAGGAAAGG - Intergenic
1136553149 16:30992489-30992511 CACCCAAGGTGGGGGTGGAGGGG + Exonic
1136602177 16:31299816-31299838 ACGACGAGGAGGGGGAGGAGGGG - Intronic
1137683188 16:50368715-50368737 ACCTCTACGAGGGTGAGGAGGGG - Exonic
1137752988 16:50880400-50880422 CCCCCTGGGTCGGGGACGAGAGG + Intergenic
1138186202 16:54979487-54979509 ACCACAGGGAGGGGGAGGAGCGG + Intergenic
1139284503 16:65798396-65798418 CCCCCTAGGAGTTTGAGCAGCGG + Intergenic
1139886746 16:70213722-70213744 CACCCTTGGAGGAGGAGGAAAGG - Intergenic
1140094091 16:71860369-71860391 CCCCCGAGGAGCGGGAGGTGAGG - Exonic
1140802144 16:78498388-78498410 GCCCCTAGGTGGGGAAGGGGTGG - Intronic
1141157782 16:81609370-81609392 CCCCCTCGGCGGGGGAGATGGGG + Intronic
1141450159 16:84094114-84094136 CCCGCTAGGAGTGGAAGGGGTGG - Intronic
1141518010 16:84559350-84559372 CCCTCTGGGTGGGGCAGGAGAGG - Intergenic
1141569887 16:84928120-84928142 GCGCCTGGGAGTGGGAGGAGGGG - Intergenic
1141757849 16:86004438-86004460 ACGCCTAGGAGGGGGATGACTGG + Intergenic
1142264452 16:89057398-89057420 CCACCTGGGAGGAGGAGGACAGG - Intergenic
1142264480 16:89057486-89057508 CCACCTGGGAGGAGGAGGACAGG - Intergenic
1142264506 16:89057576-89057598 CCACCTGGGAGGAGGAGGACAGG - Intergenic
1142372477 16:89690825-89690847 CCAGACAGGAGGGGGAGGAGGGG - Intronic
1142645042 17:1306051-1306073 CCGCCAGGGAGGGGTAGGAGTGG + Intergenic
1142994283 17:3751613-3751635 CCCCAGAGGAGAGGAAGGAGAGG + Intronic
1143448497 17:7022388-7022410 GCCCCGAGGTGGGGGTGGAGGGG - Intergenic
1143478541 17:7216369-7216391 CCCCTGAGGAGGAGGATGAGAGG - Intronic
1143587482 17:7857569-7857591 GAGACTAGGAGGGGGAGGAGAGG - Exonic
1144078188 17:11737650-11737672 CTCTCTAGCAGTGGGAGGAGAGG - Intronic
1146054537 17:29574516-29574538 CCCCTAAGGATGGGGAGGTGGGG - Exonic
1146400446 17:32496744-32496766 CCCTCCAGGAGGGCGAGCAGGGG - Intronic
1146563757 17:33894154-33894176 CCCCTTAGGGGGTGGAGAAGAGG + Intronic
1146791010 17:35750483-35750505 CCCCCTAGGAGGGGTCTGGGCGG + Intronic
1146843699 17:36170932-36170954 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146856006 17:36258866-36258888 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146864614 17:36329509-36329531 CGCCCCAGGAGGGGCTGGAGCGG + Intronic
1146871912 17:36382777-36382799 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146879273 17:36433862-36433884 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146883203 17:36455007-36455029 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1147067474 17:37930097-37930119 CGCCCCAGGAGGGGCTGGAGCGG + Intronic
1147074798 17:37983401-37983423 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1147079005 17:38009658-38009680 CGCCCCAGGAGGGGCTGGAGCGG + Intronic
1147086321 17:38062947-38062969 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1147094942 17:38133593-38133615 CGCCCCAGGAGGGGCTGGAGCGG + Intergenic
1147102267 17:38186910-38186932 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1147317568 17:39628027-39628049 ACCCCAAGGAGGGAGAGGTGGGG + Intronic
1147324858 17:39665293-39665315 CCCTGGAGAAGGGGGAGGAGGGG + Exonic
1149846855 17:60013417-60013439 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1150085203 17:62269994-62270016 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1150467118 17:65403161-65403183 ACCCCAGGGAGGGGGAGAAGGGG + Intergenic
1150609552 17:66723050-66723072 CCTCCTAAGGGGGGCAGGAGAGG - Intronic
1151572780 17:74935620-74935642 CGCCCTCGGATGGGGTGGAGAGG - Intergenic
1152162888 17:78680204-78680226 CGCCCGAGGAGAAGGAGGAGTGG - Exonic
1152186838 17:78862461-78862483 CTCCCTGGGAGGGGGAGCAGGGG - Intronic
1152236609 17:79142317-79142339 CCCCGTTGGAGAGGCAGGAGGGG + Intronic
1152286353 17:79415382-79415404 CTCCCTGGGTGGGGGAGGGGAGG - Intronic
1152606615 17:81294771-81294793 CCCCCTCTGCGGGGGAGGCGAGG + Intronic
1152926372 17:83089592-83089614 CCTCCTCGGAGGGGGAGGGCTGG - Intronic
1153768311 18:8395740-8395762 CCCCGTAGGGTGGGGAGGAGGGG - Intronic
1153770919 18:8415928-8415950 GCCCCTAGCAGGGAGTGGAGTGG - Intergenic
1154476794 18:14768100-14768122 CCTCCTAGGAGGTTGAGGGGTGG - Intronic
1155024490 18:21928932-21928954 TCCCCTAGGGAGGAGAGGAGTGG - Intergenic
1155479704 18:26272125-26272147 CCCACTGGGAGGAGGAGGGGTGG - Intronic
1157516431 18:48314937-48314959 ACCCCCAGGAGGGGGAGCTGAGG - Intronic
1157544702 18:48539502-48539524 TCCCCACCGAGGGGGAGGAGGGG - Intronic
1158029773 18:52949386-52949408 CCCCTAAGTAGGGGCAGGAGGGG - Intronic
1158318832 18:56241355-56241377 CCCCCTGGGATGGGGTGCAGTGG + Intergenic
1160157005 18:76441930-76441952 CGGCCGAGGAGGGGGCGGAGGGG - Exonic
1160432101 18:78819399-78819421 CCAGCTTGGATGGGGAGGAGGGG + Intergenic
1160432287 18:78819924-78819946 CTCTGCAGGAGGGGGAGGAGGGG + Intergenic
1160859335 19:1231028-1231050 CCGCCTAGGGGGGGGCGAAGGGG + Exonic
1160888962 19:1366890-1366912 CCCCCGAGGGGTGGGAGGTGTGG + Intronic
1161075524 19:2283307-2283329 CCCCTGAGAAGGGGCAGGAGGGG + Intronic
1161470767 19:4455869-4455891 CCTCCAAGGAGGGTGAGCAGGGG - Intronic
1161619988 19:5292833-5292855 CCCGGGAGGTGGGGGAGGAGAGG + Intronic
1161685819 19:5702184-5702206 CCCCCTCCGGGAGGGAGGAGTGG + Intronic
1161685940 19:5702462-5702484 CCCCCTCTGGGAGGGAGGAGTGG + Intronic
1161852722 19:6746038-6746060 CCCCCCAGGGGGGAGAGGGGTGG - Intronic
1161968276 19:7561128-7561150 CCCCCCAAGAGGGAGGGGAGTGG + Intronic
1162016151 19:7847641-7847663 ACCCCCAGGAGGGGGAGGATGGG + Intronic
1162464450 19:10831668-10831690 CCCAGGAGGAGGAGGAGGAGAGG - Exonic
1162741933 19:12778409-12778431 GCCCCTGGGAGCGGGTGGAGAGG + Intronic
1162757882 19:12871151-12871173 CCGCCAAGGAGGGCCAGGAGAGG + Exonic
1162956726 19:14102911-14102933 CCACCTGGGAAGGGAAGGAGGGG + Exonic
1163846871 19:19643115-19643137 CCCCTTAGGAGAGGGGGCAGGGG - Intronic
1164305709 19:24002826-24002848 CCTCCAAGGAGGAGGAGGGGTGG + Intergenic
1165163394 19:33832097-33832119 CCCCCTTGGTGGGGGAGGAGAGG - Intergenic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
1166039270 19:40192027-40192049 CCCCCATGGAGGAGGAGGAGGGG + Exonic
1166257256 19:41615348-41615370 GTCCCTAGGGGTGGGAGGAGAGG + Intronic
1166291247 19:41864964-41864986 CCCACTAGAAGGGAGAGGAAGGG - Intronic
1166712260 19:44945005-44945027 ACCCCTAGGTCTGGGAGGAGTGG + Intronic
1166963880 19:46516073-46516095 CTCCTTAGGTGGGGGCGGAGGGG - Intronic
1167078653 19:47264595-47264617 CCCCCCAGGAGTGGGAGGAGCGG + Exonic
1167792680 19:51691080-51691102 GACCTGAGGAGGGGGAGGAGAGG - Intergenic
1168292169 19:55362114-55362136 CCCCTGAGTAGAGGGAGGAGGGG - Intronic
1168345852 19:55649903-55649925 CCCCCTAGGAGTCAGAAGAGAGG - Intronic
1168645904 19:58059321-58059343 CCGGCGAGGAGGGGGAGGGGAGG + Intronic
925013508 2:503900-503922 CCGCCTGGGAAAGGGAGGAGAGG + Intergenic
926069795 2:9877862-9877884 TCCCCTTGGTGGGGGAGGAGAGG - Intronic
926233590 2:11023054-11023076 CCCACCTGGAGGGTGAGGAGTGG + Intergenic
928311839 2:30217717-30217739 CCCAGCAGGAGGTGGAGGAGGGG + Intergenic
929453922 2:42053443-42053465 CTCCCTGGGTGGAGGAGGAGTGG - Intronic
929596416 2:43179060-43179082 CCCCGGAGGAAGGGGAGCAGGGG - Intergenic
932209941 2:69919255-69919277 ACCCCTTGTAGGTGGAGGAGAGG - Intronic
932254550 2:70273087-70273109 CTCCCTGGGAGGGGGCGGGGTGG - Intronic
932283554 2:70514713-70514735 CCCCTGAGGAGGGGGCAGAGAGG + Intronic
932329893 2:70892233-70892255 CACCCTGGCAGGAGGAGGAGAGG + Intergenic
932344786 2:70988446-70988468 CCCCCAAGGAGGGTGGGGATGGG + Exonic
934659924 2:96137940-96137962 CCACCTATGAGGTAGAGGAGGGG + Intronic
934721186 2:96578029-96578051 CTCCCTACTTGGGGGAGGAGGGG + Intergenic
935088398 2:99870389-99870411 CCCCACAGCAGGTGGAGGAGAGG + Intronic
935374230 2:102379050-102379072 ACCCTTAGGATGGGGAGGAGAGG - Intronic
935500305 2:103830918-103830940 CCACCTAGGAGGAGTGGGAGTGG + Intergenic
935550795 2:104451333-104451355 ACCCTTGGGATGGGGAGGAGAGG + Intergenic
937046559 2:118855012-118855034 CCCCCTGGTGGGTGGAGGAGAGG - Intergenic
937226744 2:120374721-120374743 CTCCCTGGGAAGGGGAGGGGAGG + Intergenic
938286185 2:130119918-130119940 CCCTCCTGGCGGGGGAGGAGGGG - Intronic
938336827 2:130508638-130508660 CCCTCCTGGCGGGGGAGGAGGGG - Intronic
938352996 2:130611997-130612019 CCCTCCTGGCGGGGGAGGAGGGG + Intronic
938429424 2:131218978-131219000 CCCTCCTGGCGGGGGAGGAGGGG + Intronic
938574719 2:132593282-132593304 ACCTCTAGGAGGGAGAGGAGGGG - Intronic
939010401 2:136839594-136839616 TCTCCTAGGATGGAGAGGAGGGG - Intronic
939690191 2:145250163-145250185 CACCATGGGAAGGGGAGGAGAGG + Intergenic
942248808 2:174030818-174030840 CTCACGAGGAAGGGGAGGAGGGG + Intergenic
944413672 2:199463861-199463883 GCCCCTACGAGGGGTGGGAGCGG - Intronic
945185276 2:207133729-207133751 CCTCTTAAGAGGGGGAGGGGGGG + Intronic
947638456 2:231692788-231692810 GCCCCTAGGAGGGGAAAGGGTGG + Intergenic
947827934 2:233118752-233118774 TCCCCTCGGAGGGGGAGAGGTGG + Intronic
948056176 2:235010751-235010773 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056183 2:235010775-235010797 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056194 2:235010820-235010842 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056201 2:235010844-235010866 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056212 2:235010889-235010911 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056265 2:235011117-235011139 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056272 2:235011141-235011163 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056279 2:235011165-235011187 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948163991 2:235846962-235846984 CCTCTTAGGATGGGGAAGAGGGG - Intronic
948833602 2:240613204-240613226 CCACCCAGAAGGAGGAGGAGAGG + Intronic
948884964 2:240877858-240877880 CCCCTTAGGAGGCGGTGGATGGG - Intronic
1169980577 20:11379763-11379785 CTCCCTAGGTGGGGGAAGGGCGG + Intergenic
1171367411 20:24635090-24635112 CCCGCTGGCAGGGTGAGGAGTGG - Intronic
1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG + Exonic
1172761690 20:37327882-37327904 CCCCGCAGCGGGGGGAGGAGAGG - Intergenic
1172951003 20:38723613-38723635 CCCGCTAGGAGGCTGACGAGAGG + Intergenic
1173221929 20:41138064-41138086 CCCCCCAGCTGGGGGAGGGGGGG - Intronic
1174271601 20:49373491-49373513 ATCCCTAGAACGGGGAGGAGTGG + Exonic
1174805184 20:53598964-53598986 TTCCCTGGGAGGGGGAGGAGGGG + Intronic
1175827085 20:61942196-61942218 CCCCCTCGGATGGAGAGGACAGG + Intergenic
1175829382 20:61953697-61953719 CCCCATGGGAGGGGGACGGGGGG - Intronic
1176100247 20:63361387-63361409 CCGGCTGGGAGGGGGAGCAGGGG + Exonic
1176549269 21:8214453-8214475 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1176557162 21:8258676-8258698 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1176568201 21:8397491-8397513 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1176576104 21:8441711-8441733 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1177051246 21:16237741-16237763 CCCCCAAGTAGGGGGATTAGTGG - Intergenic
1178690034 21:34743043-34743065 CCCCCCAGGAGGGGCTGGAGCGG + Intergenic
1179903481 21:44406948-44406970 CCCACCAGGGGAGGGAGGAGGGG + Intronic
1179930492 21:44568208-44568230 TCCCCCAGGAGCAGGAGGAGGGG - Intronic
1180090815 21:45533113-45533135 CCTCCCAGGAGGGGGAGCACAGG + Intronic
1180613001 22:17109558-17109580 CGCCCTACGAGGAGGAGCAGCGG + Exonic
1180649877 22:17369312-17369334 CCGCCAGGGAGGGGGAGGGGCGG - Intronic
1182105004 22:27682808-27682830 CCCCCTAGAAATGGGGGGAGGGG + Intergenic
1182144522 22:27989070-27989092 GCCCCTAAGTGGGGCAGGAGGGG + Intronic
1182777226 22:32839988-32840010 CTCCCGGGGAAGGGGAGGAGGGG - Intronic
1183710162 22:39498637-39498659 ACCCCTGGGAGGGGGTGGGGAGG + Intergenic
1183784019 22:40018919-40018941 ACCCCCAGGATGGGGAGGTGGGG + Intronic
1183787499 22:40038654-40038676 ACCCCTCAGAGGAGGAGGAGGGG + Exonic
1184235446 22:43180703-43180725 GCCCCGGGGAGGGGGAGGACAGG - Intronic
1184347814 22:43924143-43924165 CCCCCTAGGCCGGGGAGCGGGGG + Intronic
1184507510 22:44913378-44913400 GCCCCTAGGATGGGGTGTAGTGG + Intronic
1184763753 22:46561053-46561075 ACCCCCAGGAGGGTGAGGAAGGG + Intergenic
1184789251 22:46689207-46689229 ACCCCGAGGATGGGAAGGAGAGG - Intronic
1185294443 22:50046324-50046346 GACCCCAGGAGAGGGAGGAGCGG + Intronic
1185345147 22:50307688-50307710 CCCCCGACGAGGGAGAGGAGGGG + Intergenic
1185413242 22:50696962-50696984 GCCCACAGGAGGGGAAGGAGAGG + Intergenic
1203254154 22_KI270733v1_random:130769-130791 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1203262210 22_KI270733v1_random:175848-175870 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
949603068 3:5622433-5622455 CCCCCAAATAGGGGGTGGAGGGG - Intergenic
950652228 3:14414373-14414395 CCACCTAGGAGGAGGAGGTGGGG + Intronic
951582346 3:24179189-24179211 CCCCCTTGGAGGGGGAGTTGAGG - Intronic
952331069 3:32364967-32364989 GCTGCTAGGAAGGGGAGGAGGGG - Intronic
952384832 3:32832782-32832804 CCCCCTAGGAAGGGAGGAAGAGG - Intronic
952905747 3:38138272-38138294 CCCTCGAGGATGGCGAGGAGGGG - Intergenic
953582953 3:44173430-44173452 CCCACTAGCAGAGGGAGCAGAGG + Intergenic
953850665 3:46463711-46463733 CCACCTGGGAGGGGCAGGAGAGG - Intronic
954438743 3:50510059-50510081 CCCCCTTGGTGGGGGAGGCTGGG - Intergenic
954448247 3:50557970-50557992 AACCCTAGGAGGGGCAGGATGGG - Intergenic
955774819 3:62421659-62421681 CCCCAAAGGAGGGGGAAGGGGGG + Intronic
957847356 3:85755237-85755259 CCAACCTGGAGGGGGAGGAGAGG - Intronic
958481948 3:94654246-94654268 CTCCCTAGGTGGGGGAAGGGAGG - Intergenic
960413713 3:117358973-117358995 CTCCCTGGGTGGGGGAAGAGCGG + Intergenic
964119493 3:153167836-153167858 TCCCCTAGGTTGGGGAGAAGGGG - Intergenic
964761378 3:160137692-160137714 CCCCAGAAGAGGGGGAGGAGAGG - Intergenic
964906785 3:161726833-161726855 CCCCCAGGGAGGCGGAGAAGGGG + Intergenic
965799458 3:172476489-172476511 CCCTCCAGGAGGGAGAGGATTGG + Intergenic
966474364 3:180326288-180326310 CTACCTAAGAGGAGGAGGAGAGG - Intergenic
967812965 3:193775809-193775831 CCCCGCAGGAGAGGGAGGAGGGG + Intergenic
968088162 3:195883522-195883544 TCCCCCAGGAAGGGGAGGTGTGG - Intronic
968473565 4:792529-792551 CCGCCAAGAAGGAGGAGGAGCGG - Exonic
968500807 4:949044-949066 CCCCCTAGGGAGGGCGGGAGCGG - Intronic
968650152 4:1757220-1757242 CCCGCTTGGAGCGGGAGGGGTGG + Intergenic
968952723 4:3702983-3703005 GCTCCAAGGAGAGGGAGGAGGGG + Intergenic
969470254 4:7383382-7383404 GCCTCTTGCAGGGGGAGGAGGGG - Intronic
970008041 4:11428924-11428946 ATCCCGAGGAGGGGGAGGAGCGG + Exonic
970494274 4:16609453-16609475 CTCCCTAGGTAGGGGAAGAGTGG + Intronic
970494334 4:16609712-16609734 GCCCCTAGGCGGAGGGGGAGAGG + Intronic
971355975 4:25895663-25895685 CCCGCTGGCAGGGGGAGGAGAGG + Intronic
971977329 4:33707604-33707626 CCCTCAAGGAGGGAGAAGAGTGG - Intergenic
972311866 4:37890364-37890386 CCTCCAAGGACGGGGAGAAGGGG + Intergenic
972353618 4:38260133-38260155 ACCCCTAGGGCTGGGAGGAGTGG - Intergenic
972718530 4:41673349-41673371 CCCCCTGGGTAGGGGTGGAGAGG + Intronic
973293407 4:48490956-48490978 GCCCAGAGGAGGGGGAGGTGTGG + Exonic
974839878 4:67287273-67287295 CAAAGTAGGAGGGGGAGGAGAGG + Intergenic
975281782 4:72569530-72569552 CGCCCTAGGCGGAGAAGGAGAGG - Intergenic
979393906 4:120162704-120162726 CTCCCATGGAGGAGGAGGAGAGG - Intergenic
983077022 4:163338512-163338534 CCACCTAGAAGGGGCAGAAGGGG - Intronic
985836605 5:2276593-2276615 ACCCCTAGCATGGAGAGGAGCGG - Intergenic
986030875 5:3891351-3891373 GCCCCTGGGAGGAGGGGGAGTGG + Intergenic
986741978 5:10712486-10712508 CCACATAGGAAGGGCAGGAGAGG + Intronic
986743539 5:10724909-10724931 CCCCCCAGGAGGAGAAGGTGGGG + Intronic
994354796 5:98783053-98783075 TTCCCAAGGAAGGGGAGGAGAGG - Intronic
995809842 5:116093357-116093379 CACCTGAGGAGAGGGAGGAGAGG + Intronic
997472737 5:134125689-134125711 GCCCCAAGGAGGGGGAGCACTGG + Intronic
998130355 5:139648619-139648641 GCCGCGGGGAGGGGGAGGAGGGG + Exonic
999290179 5:150419851-150419873 CCCTCAAGGAGGGGGACGGGTGG - Intergenic
1001444870 5:171775338-171775360 GCCCGAAGGAGGGGGAGGTGGGG - Intergenic
1001892128 5:175348424-175348446 CTCAGTAGGAGGGGAAGGAGAGG - Intergenic
1002169340 5:177366689-177366711 ACTCCTGGGAGGGGAAGGAGGGG - Exonic
1002534616 5:179869469-179869491 CCCACTAGGAGGGCCATGAGTGG - Intronic
1004590167 6:17042974-17042996 CCCCATGGGAGGGGCAGGAGAGG + Intergenic
1005995593 6:30929293-30929315 CCCCCAAGGAGAGGTAGCAGGGG - Intergenic
1006135864 6:31896475-31896497 CCCCCTTGCTGGGGGAAGAGGGG + Exonic
1006377661 6:33680484-33680506 CCCCCCAGGAGGTGTGGGAGTGG + Intronic
1006951011 6:37820452-37820474 CTCCGGAGGACGGGGAGGAGGGG - Intronic
1009437621 6:63636069-63636091 CCGCCGAAGAGGAGGAGGAGGGG - Exonic
1010533338 6:76992807-76992829 CCCCCTAGGAGTTTGAGCAGAGG + Intergenic
1011450083 6:87483304-87483326 TCCCCTAGGGGAAGGAGGAGAGG - Intronic
1014632413 6:123803460-123803482 CCCCCTGGGAGGGGGCGGCAGGG + Intergenic
1018899352 6:168043434-168043456 CACCCTGGGAGGTGGTGGAGGGG + Intronic
1019358584 7:593637-593659 CCCCCTGAGAGGGGCTGGAGCGG - Intronic
1019657918 7:2207413-2207435 CCTCCTAGGAGGTTGAGGGGTGG - Intronic
1019718643 7:2555009-2555031 GCCAGTAGGAGGGTGAGGAGGGG + Intronic
1020013384 7:4818133-4818155 CCCCACAGGAGGGAGAGGAGGGG - Intronic
1020013764 7:4819750-4819772 GCCCCTAGAAGGGGCCGGAGGGG - Intronic
1020289772 7:6714552-6714574 CCTCCTAGGATGGGGTGGGGTGG - Intergenic
1021192057 7:17632156-17632178 TCCCTTAGGAGTGGGAAGAGAGG - Intergenic
1022108336 7:27212789-27212811 CCACCTCGGAGGGGCAGAAGTGG - Intergenic
1022517740 7:30986764-30986786 CCCCAAAGGAGGCGGAGCAGGGG + Intronic
1023982033 7:45075963-45075985 CACCCTCAGAGGGGGATGAGTGG + Exonic
1025282586 7:57638917-57638939 CACCCTAGGATGGGCAGCAGCGG + Intergenic
1026598595 7:71754469-71754491 ACCGGGAGGAGGGGGAGGAGGGG - Intergenic
1026639661 7:72113207-72113229 CTCTCTGGGAGGAGGAGGAGGGG + Intronic
1027035580 7:74922794-74922816 GCCCCATGGAGGGGAAGGAGGGG + Intergenic
1027236098 7:76298812-76298834 CCCCATAGAAGTAGGAGGAGTGG + Intergenic
1029394478 7:100298343-100298365 GCCCCATGGAGGGGAAGGAGGGG - Intergenic
1030176646 7:106661021-106661043 CGCCCTCGGAGGGGGAGGGGCGG - Intergenic
1030207636 7:106966476-106966498 CCCCCTAGGAGTCTGAGCAGCGG - Intergenic
1032174346 7:129611684-129611706 CCGCCGAGGAGGGGGAGGGGAGG - Intergenic
1033347177 7:140534586-140534608 CCCTCAAGGAGGGGGATGGGAGG + Intronic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1034179475 7:149126378-149126400 CCCCCTGCGGGCGGGAGGAGCGG + Intergenic
1035170766 7:157016220-157016242 CACCCTAGTGGGAGGAGGAGAGG + Intergenic
1035491672 7:159284769-159284791 CTCCCTAGGTGGGGGAAGAGTGG + Intergenic
1035583164 8:752844-752866 CCTTCTTGGAGGGGCAGGAGTGG - Intergenic
1036177953 8:6557023-6557045 CCACCTAGGAGGGGTGGGCGGGG + Intronic
1036748130 8:11424496-11424518 CCACCTACGAGCTGGAGGAGCGG - Exonic
1036830091 8:12014537-12014559 GCCCCTAGCAGGGGAAGGGGCGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039375074 8:37024825-37024847 CCACCTAGGTGGGTTAGGAGTGG - Intergenic
1041254208 8:55965357-55965379 TCTCCTGGGTGGGGGAGGAGTGG + Intronic
1044710087 8:95048869-95048891 GCCCCTGGGAGGGGGACGAGAGG - Intronic
1045383293 8:101647865-101647887 CCCCCCAGGATTGGGAGGAGGGG + Intronic
1045443638 8:102239075-102239097 GCCCCGAGGCGGGGGAGGCGGGG - Exonic
1048553626 8:135456077-135456099 CACCTTAGCCGGGGGAGGAGTGG + Intergenic
1049331610 8:142057019-142057041 CTCCCTAGGCTGGGGAGGGGTGG - Intergenic
1049591258 8:143463875-143463897 CCCCCCAAAAGGGGAAGGAGCGG + Intronic
1049763709 8:144343188-144343210 CTCCAGAGGAGGGGGAGGAAAGG + Intergenic
1050509300 9:6377001-6377023 CCCCCCAGAAGGGGGTGGACTGG + Intergenic
1050813439 9:9778604-9778626 GCCCCTAGGAGGGGGCAGACAGG - Intronic
1055315221 9:75028062-75028084 GCACCGAGGAGGAGGAGGAGAGG - Exonic
1056442778 9:86637225-86637247 GACCCTATGTGGGGGAGGAGGGG + Intergenic
1057266477 9:93621176-93621198 CAGCCTTGGAGGGGCAGGAGGGG + Intronic
1057497364 9:95571826-95571848 CCCAGGAGGAGGAGGAGGAGAGG + Intergenic
1057630446 9:96715625-96715647 CCCCGTCCGAGGGGGAGGTGGGG - Intergenic
1058056916 9:100457917-100457939 CCTCCTAAGAAGGTGAGGAGAGG + Intronic
1059434973 9:114270642-114270664 GCCCCAGGGAGGGGGAAGAGAGG + Intronic
1060201555 9:121654536-121654558 CCACCAAGGAGGAGGAGGACAGG - Intronic
1060414404 9:123420411-123420433 CCACCTGCGAGGGGGATGAGGGG + Intronic
1060667122 9:125438708-125438730 CCCCCTAGGAGGGAGCGCTGGGG - Exonic
1061146624 9:128803323-128803345 CCCACTGGGAGGTGGTGGAGCGG + Exonic
1061790073 9:133054607-133054629 TCCCCTAGGAGGGGGTGGGCTGG + Intronic
1062033378 9:134372026-134372048 CTCCCTGGGGAGGGGAGGAGAGG + Intronic
1062046531 9:134426991-134427013 AGCCGTAGGAGGGGCAGGAGTGG + Intronic
1062190863 9:135247178-135247200 CCCCCTTGGAGGGTGGGGAGAGG - Intergenic
1062600206 9:137316014-137316036 GCCCCGGGGAGGGGGAGAAGGGG - Intronic
1062670412 9:137705666-137705688 CCCACGCGGAAGGGGAGGAGGGG + Intronic
1203794674 EBV:169995-170017 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203794875 EBV:170533-170555 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795066 EBV:171056-171078 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795267 EBV:171594-171616 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203470555 Un_GL000220v1:113913-113935 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1203478376 Un_GL000220v1:157885-157907 CCTCCGGGGAGGAGGAGGAGGGG - Intergenic
1187478630 X:19634631-19634653 GCCACAAGGAGGAGGAGGAGAGG + Intronic
1187488149 X:19724120-19724142 CCCTCTGAGAGGGGGAGGAAAGG - Intronic
1187859584 X:23667940-23667962 TCACCTAGGAGGGCGGGGAGGGG + Intronic
1188884377 X:35531566-35531588 GCCCCTAGGGGGTGGAGGGGTGG + Intergenic
1189262751 X:39689584-39689606 GCCCCTCGGTGGGGGTGGAGGGG + Intergenic
1189695521 X:43657651-43657673 ACACCTAGTAGGGGGAGGATAGG - Intronic
1190915262 X:54807657-54807679 CCCCCGAGGAAGGCGAGGGGGGG + Exonic
1192168660 X:68841299-68841321 CCTCGTAGGAGGGTCAGGAGGGG - Exonic
1194974527 X:100380183-100380205 CCACCTTGGTGGGGGAGGGGTGG + Intronic
1195126209 X:101812299-101812321 CCCCCTAGTAGGGGCAGTAGGGG - Intergenic
1196106223 X:111898865-111898887 TCTCCTTGGTGGGGGAGGAGTGG - Intronic
1196657041 X:118229212-118229234 CCCTCTAGGAGGCCGAGGCGGGG - Intergenic
1196919359 X:120569764-120569786 CAGCCTAGGAGGGTGAGGTGGGG + Intronic
1199227348 X:145393734-145393756 ACCCCAAAGAGGGGGTGGAGAGG - Intergenic
1199230652 X:145433955-145433977 ACCTCCAGGAAGGGGAGGAGAGG - Intergenic
1200086855 X:153611339-153611361 GCCCCAAGGATGGGGAGGGGAGG - Intergenic
1201296274 Y:12465893-12465915 CCCAGTAGGAGGAGGAGTAGGGG - Intergenic