ID: 1083674811

View in Genome Browser
Species Human (GRCh38)
Location 11:64319315-64319337
Sequence CTGAGGGTCCCACCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083674811_1083674818 12 Left 1083674811 11:64319315-64319337 CCTCCTGAGGGTGGGACCCTCAG 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1083674818 11:64319350-64319372 TCCTCTCCCTCCATGTTGTCAGG 0: 1
1: 0
2: 1
3: 19
4: 231
1083674811_1083674820 13 Left 1083674811 11:64319315-64319337 CCTCCTGAGGGTGGGACCCTCAG 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1083674820 11:64319351-64319373 CCTCTCCCTCCATGTTGTCAGGG 0: 1
1: 0
2: 1
3: 29
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083674811 Original CRISPR CTGAGGGTCCCACCCTCAGG AGG (reversed) Intronic
900480207 1:2894530-2894552 CTGAGTGTGCCACCCTCCGGAGG + Intergenic
902568487 1:17331449-17331471 CTGAGGGTGCAGCCCTCATGGGG + Intronic
902838964 1:19063432-19063454 CTCAGCGCCCCACCCTCCGGCGG + Intergenic
903655037 1:24943759-24943781 CTGAGGACCCTGCCCTCAGGGGG - Intronic
904260253 1:29283869-29283891 CTGAGGTTCCCACCCTGGGGAGG + Intronic
904750978 1:32741554-32741576 CTGAGGTTCCGTCCCGCAGGGGG - Intergenic
905321561 1:37120825-37120847 CTCAGAGTCCCACACTCAGAAGG - Intergenic
906653694 1:47533064-47533086 CTGTGGGTCACAGCCTCATGTGG - Intergenic
907339140 1:53721558-53721580 CTGTGGTGCCCACCTTCAGGGGG - Intronic
909959748 1:81825239-81825261 CTGTGGTCCCCACTCTCAGGAGG + Intronic
911094462 1:94044380-94044402 CTGAGGGCTCCTCCCTCAGAAGG - Intronic
914509312 1:148317508-148317530 CTGAGGGCCTGCCCCTCAGGAGG + Intergenic
915934246 1:160081593-160081615 CTGCGGCTCCCACCCTTCGGGGG + Exonic
920066630 1:203273923-203273945 CTGGGGCTCCCAGCCTGAGGAGG + Intergenic
922078103 1:222268017-222268039 CACAGGGCCCCACCCTCAGAAGG + Intergenic
924842907 1:247733060-247733082 CTGAGGGCCGCAGTCTCAGGGGG - Intergenic
1066204368 10:33173154-33173176 CTCACAGTCCCACACTCAGGAGG + Intergenic
1066806372 10:39259648-39259670 CTGAGGGTCCCACACCCACAGGG + Intergenic
1067177848 10:43962657-43962679 CAGAGGGTCCCACCCTCTGATGG - Intergenic
1068771460 10:60826202-60826224 CTGTGGCTCCCACCCAGAGGTGG + Intergenic
1069752106 10:70751487-70751509 CTGCGGGGGCCACCCTCAGTTGG - Exonic
1070281472 10:75051969-75051991 TTGAGGCTCCCTCCCTCAGCTGG + Intronic
1070305873 10:75238843-75238865 CTGAGGGCCCTGCGCTCAGGTGG + Intergenic
1070312655 10:75284678-75284700 CTGATGGTCTCACCACCAGGTGG + Intergenic
1070698327 10:78579754-78579776 CTGCGGGTCCCACATCCAGGAGG + Intergenic
1070793506 10:79203556-79203578 CAGAGGGTCCCATGCACAGGAGG - Intronic
1072365369 10:94703670-94703692 CACAGGATCCCACCCTCATGGGG - Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1077031995 11:472521-472543 CTGAGGGTCTCACCCTCGGCAGG - Intronic
1077225253 11:1436713-1436735 CTCCGGGTCCCACCCACAGTGGG + Intronic
1077484455 11:2832386-2832408 CTGACGGCCCCACTCCCAGGAGG - Intronic
1077576931 11:3391038-3391060 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1077606559 11:3616437-3616459 CTGGGGGCCCCTTCCTCAGGTGG - Intergenic
1079040225 11:17052733-17052755 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1081102830 11:39026309-39026331 GTTCGGGTCCCTCCCTCAGGAGG - Intergenic
1081626121 11:44656205-44656227 CCGAGGACCCCTCCCTCAGGAGG - Intergenic
1083554263 11:63613743-63613765 CTGAGGGTCCCGCCTTCCGCTGG + Intronic
1083674811 11:64319315-64319337 CTGAGGGTCCCACCCTCAGGAGG - Intronic
1084228872 11:67735825-67735847 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1084531295 11:69729412-69729434 CTGAGACTTCCATCCTCAGGAGG + Intergenic
1084846401 11:71903869-71903891 CTGAGGGTTTCATCATCAGGTGG + Intronic
1085300654 11:75456382-75456404 CTGTGGCACCCACCCTCTGGGGG - Intronic
1085518059 11:77122754-77122776 CTGAGGCTTCCCCACTCAGGGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1088952921 11:114588939-114588961 CTAAGGTGGCCACCCTCAGGAGG - Intronic
1089775382 11:120832021-120832043 GGGAGGCTCCCACCTTCAGGAGG - Exonic
1090182858 11:124716282-124716304 TTGTGGCTCCCAGCCTCAGGAGG + Intergenic
1090782409 11:130019379-130019401 CTGAGGCTGCTACCCGCAGGTGG + Intergenic
1091347468 11:134864805-134864827 CTCAGGTTCCCATGCTCAGGAGG - Intergenic
1094830296 12:34297102-34297124 GTGCGTGTCTCACCCTCAGGTGG + Intergenic
1096507937 12:52108012-52108034 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1097215532 12:57408766-57408788 ATGAGAGTTCCACCCTCATGAGG + Intronic
1099277973 12:80602516-80602538 GTGAGGGTTGCACCCTCTGGAGG + Intronic
1099751022 12:86772586-86772608 ATGAGGCTGCCACCCTGAGGGGG + Intronic
1104440488 12:128789691-128789713 CTGAGGTTCCCAGGCTAAGGAGG - Intergenic
1104756938 12:131275253-131275275 CCGTGGGTCCCAGCCTCAGAGGG + Intergenic
1104915141 12:132260568-132260590 CTGAGGTTCCCACCCCGCGGGGG + Intronic
1106440556 13:29763331-29763353 CTGAGGGTCCCACTCTGCTGCGG + Intergenic
1107545677 13:41431496-41431518 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1107547072 13:41443409-41443431 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1107918949 13:45183382-45183404 CTGTGGCTTCCATCCTCAGGGGG + Intronic
1109193267 13:59350777-59350799 CTGAGGGTCACAGCCTCAGATGG - Intergenic
1115628490 14:35219333-35219355 CAGAAGGCCCCACCCTGAGGTGG - Intronic
1117040316 14:51763323-51763345 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1119320323 14:73726567-73726589 CTGAGGGGCCCTCCCTCTGCTGG + Intronic
1119728618 14:76937302-76937324 CTGAGGGTGCCACGCCCAGCTGG + Intergenic
1120681273 14:87483876-87483898 CTGAGCTTCCCCCACTCAGGAGG + Intergenic
1124370466 15:29101855-29101877 CTGTGGAAACCACCCTCAGGTGG + Intronic
1126067822 15:44839407-44839429 CAGAGGTTCCCATCATCAGGGGG + Intergenic
1129330131 15:74822950-74822972 CAGACACTCCCACCCTCAGGAGG + Intronic
1129521605 15:76189842-76189864 CAGAGGGTCCCACTTTTAGGGGG - Intronic
1129868125 15:78924276-78924298 CCCAGGGTCCTACCCTGAGGGGG - Intronic
1130094738 15:80847545-80847567 CTGGGGGTCCTACTCCCAGGTGG - Intronic
1130274431 15:82469160-82469182 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1130466778 15:84196534-84196556 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1130497486 15:84477002-84477024 CTGAGGCTCAGGCCCTCAGGTGG + Intergenic
1130589073 15:85201127-85201149 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1131111416 15:89767304-89767326 CTGCAGGTCCCAGCCCCAGGGGG - Intronic
1132341979 15:101084794-101084816 CTGTGTGTCCCACCCTCCTGGGG - Intergenic
1132498489 16:274758-274780 CTGAGGCTCCATCCCTCAGCCGG + Intronic
1132773067 16:1575429-1575451 CCTATGGTCCCACGCTCAGGAGG + Intronic
1132889961 16:2198981-2199003 CTGCGTGGCCCACCTTCAGGAGG + Intergenic
1133067129 16:3216283-3216305 CTGAGGGTCCCATCCACAAAGGG + Intergenic
1133393359 16:5426986-5427008 CTGAGGGCCCTACACTCAGCTGG - Intergenic
1133636212 16:7668209-7668231 CCGAGGGCTCCAACCTCAGGTGG - Intronic
1137072316 16:35914317-35914339 CAGAGAGTACGACCCTCAGGAGG - Intergenic
1137274150 16:46922514-46922536 CTGCAGGCCACACCCTCAGGAGG - Intronic
1137660712 16:50203779-50203801 CAGAAGGTCCCTCCCTAAGGAGG + Intronic
1140473992 16:75229496-75229518 CTGGGGTCACCACCCTCAGGCGG + Exonic
1141154497 16:81587796-81587818 CTGAGGCTCTCACCCTCAGGAGG - Intronic
1143772619 17:9178332-9178354 CTGGGGGTGCCCCCATCAGGTGG - Intronic
1143779405 17:9221469-9221491 CTGGGTGTCCCAGCCTCAGGAGG - Intronic
1146445412 17:32928444-32928466 CTGGGGGTCCCTCCCTCCCGGGG + Intronic
1146660949 17:34664884-34664906 CTGGGGGTCTCAGCCTGAGGTGG + Intergenic
1146679441 17:34796439-34796461 CTCAGGGGCCCAGCCTCAGAGGG - Intergenic
1147769170 17:42856023-42856045 CTGTGGGTGTCACCCTCTGGGGG + Intronic
1148615460 17:48997244-48997266 TTGAGTTCCCCACCCTCAGGCGG + Intergenic
1148786607 17:50148996-50149018 CAGAAGTTCCCACCCTCAGGGGG - Intronic
1151000558 17:70370503-70370525 CTGTGGTTCCCACCCAGAGGTGG - Intergenic
1151880222 17:76890160-76890182 CTCAGGGTCACCCCCTCAGAAGG + Intronic
1151964871 17:77426022-77426044 CAGAGGGTCCCAGCCTCAGGAGG + Intronic
1152017156 17:77758167-77758189 CTGGGGTTCCAACGCTCAGGTGG + Intergenic
1152754321 17:82080819-82080841 CGGAGGGCCCCACCCTGATGCGG - Exonic
1155154206 18:23144487-23144509 CTGTCTCTCCCACCCTCAGGAGG + Intronic
1160343733 18:78112018-78112040 CTGCCAGTCCCACCTTCAGGTGG + Intergenic
1161279619 19:3438738-3438760 CTGAGGATGAAACCCTCAGGAGG - Intronic
1161313147 19:3606236-3606258 ATGGGGGTCCCAGACTCAGGGGG - Intronic
1161604402 19:5206688-5206710 CTGGGGGTCCAGGCCTCAGGAGG + Exonic
1162230401 19:9261202-9261224 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1162303682 19:9858507-9858529 CTGAGGGTCCCACCTGAAGGAGG - Intronic
1163450958 19:17377246-17377268 CGGAGGGTCCTACGCTCGGGCGG - Exonic
1164596205 19:29531907-29531929 CTGAGAGTACCAGCCTCAGCAGG + Intronic
1165123617 19:33579095-33579117 CTCGGGATCCCATCCTCAGGAGG + Intergenic
1165403312 19:35615393-35615415 CTCAGGGACCCACCCTCACCAGG + Intronic
1166571033 19:43797596-43797618 CTGAGAGCCCCACCAGCAGGAGG + Exonic
1167137105 19:47623388-47623410 CTGGGGGTCTGACCCTCATGAGG - Intronic
1167648976 19:50719477-50719499 CTGAGGGTCCCCGTCTCCGGGGG - Intergenic
927789321 2:25998023-25998045 CTGAGGATACCACCCCCAAGTGG - Intergenic
932000180 2:67877807-67877829 CTGAGGGTCCCCCATTCTGGAGG + Intergenic
932351774 2:71038414-71038436 CTGAGGGTTTCATCATCAGGTGG + Intergenic
935311361 2:101787166-101787188 TTGAGTGACCCACCATCAGGTGG + Intronic
935732061 2:106072665-106072687 CTCAGGGGCCCTCCCACAGGTGG + Intronic
936677626 2:114733588-114733610 ATAAGGTTCCCAGCCTCAGGAGG + Intronic
937265543 2:120612682-120612704 CTTAGGAGCCCACTCTCAGGTGG - Intergenic
940871338 2:158863022-158863044 CTGAGGGTTTCATCATCAGGTGG + Intergenic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
943929983 2:193836641-193836663 CAGAGGGTCCCACGCCCAGAGGG - Intergenic
944137232 2:196412985-196413007 CTCTGGTTCCCACCATCAGGTGG + Intronic
948032609 2:234831406-234831428 CCGAGGGTCCCTGCCTCAAGAGG - Intergenic
948613505 2:239184451-239184473 CTGAGGGACCCCCCCTCATAGGG - Intronic
1169210739 20:3764995-3765017 ATGTGGGTCCTACCCTCAGTGGG - Intronic
1170573868 20:17648144-17648166 TTCAGGGTCCCACCCCGAGGTGG + Intronic
1171126177 20:22603774-22603796 CTGAGGATCCAACCCACAGCAGG - Intergenic
1171458099 20:25283115-25283137 CTAGGGGGCCCAGCCTCAGGAGG + Intronic
1172448075 20:35003387-35003409 GTGAGTGCCCCACCCTCAAGGGG - Intronic
1172523282 20:35582901-35582923 CCCAGGGTCCCTTCCTCAGGGGG + Intergenic
1172646368 20:36472804-36472826 CTGAGGGACCCAGGCCCAGGTGG + Intronic
1175596906 20:60242344-60242366 CTGTGGGTCCCACCCACAGATGG + Intergenic
1176217665 20:63955972-63955994 CCGAGGGCCCCACCCACCGGGGG + Intronic
1178443960 21:32621777-32621799 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1179974154 21:44854195-44854217 TTTAGGGTCCCACCCACTGGGGG - Intronic
1180183445 21:46128143-46128165 CTGAGTGACCCACTCCCAGGAGG - Intronic
1182355997 22:29722437-29722459 CTGAGGGGCCCTGACTCAGGGGG + Intronic
1183164154 22:36134815-36134837 ATCAGGGTCCCACCCTCACCTGG + Intergenic
1184230235 22:43154829-43154851 CCCTGGGTCCCACCCTCAGTGGG + Intronic
1184521389 22:44996223-44996245 CTGAGGTTCCCAGCCTCGGCAGG - Intronic
1184792389 22:46708050-46708072 CTGAGGCTTCCAGCTTCAGGAGG + Intronic
1184847509 22:47098413-47098435 CTGATGCTGCCACCCCCAGGTGG + Intronic
950766228 3:15275069-15275091 CTGAGGGTGGGACCCTCATGAGG + Intronic
951080449 3:18445215-18445237 CCGAGGCTCCCACCGCCAGGGGG - Intronic
951801043 3:26596361-26596383 CTGAGGCTCAATCCCTCAGGGGG + Intergenic
952534053 3:34291703-34291725 CTCAGGGTCCCAAGCTCAGCAGG + Intergenic
952582068 3:34846146-34846168 TTGAGTTTCCCAACCTCAGGAGG - Intergenic
952696044 3:36266134-36266156 CTGAGGGTACCACACTTAGAAGG + Intergenic
954147650 3:48642226-48642248 CCCAGGGTCCCTGCCTCAGGAGG - Intronic
954510509 3:51120901-51120923 CAGCGGATCCCACCCTCACGGGG - Intronic
957045460 3:75370641-75370663 CTGAGGGTTTCATCATCAGGTGG - Intergenic
959129616 3:102338323-102338345 CTCAGGGCCCCACTTTCAGGAGG + Intronic
961032454 3:123618435-123618457 CTGAAGGACACACCTTCAGGAGG + Intronic
961274041 3:125712818-125712840 CTGAGGGTTTCATCATCAGGTGG + Intergenic
961276927 3:125734976-125734998 CTGAGGGTTTCATCATCAGGTGG + Intergenic
961877496 3:130034765-130034787 CTGAGGGTTTCATCATCAGGTGG - Intergenic
967242733 3:187456910-187456932 CTGACTGTCCCAGGCTCAGGTGG - Intergenic
967853225 3:194097652-194097674 CTGCAGGTCCCACGCTCAGAGGG - Intergenic
967976694 3:195039399-195039421 CTGCGGGCCCCACCCACAGCAGG + Intergenic
968563060 4:1295176-1295198 CTGCGAGCCCCACCCTCTGGGGG + Intronic
968989738 4:3901797-3901819 CTGAGGGTTTCATCATCAGGTGG - Intergenic
969189830 4:5508509-5508531 CTGAGAGCCCCATCCCCAGGTGG + Intergenic
969210194 4:5681446-5681468 GTGAAGGTCTCACCATCAGGAGG + Intronic
969787398 4:9469730-9469752 CTGAGGGTTTCATCATCAGGTGG + Intergenic
969825573 4:9755554-9755576 CTGAGGGTTTCATCATCAGGCGG + Intergenic
971364889 4:25969808-25969830 CTGAGGGTCCAGTCCTTAGGCGG - Intergenic
972388175 4:38587734-38587756 ATCAGGGCCCCTCCCTCAGGAGG + Intergenic
980423278 4:132592566-132592588 CAGAAGCTCCCACCCTCAGTCGG + Intergenic
984630145 4:182052387-182052409 CTGACGTTCCCACCAACAGGTGG + Intergenic
985583580 5:713823-713845 ATGAGGGTACCGCCCTCTGGGGG + Intronic
985597093 5:798120-798142 ATGAGGGTACCGCCCTCTGGGGG + Intronic
985609826 5:881200-881222 CTGAGCGTCTGTCCCTCAGGAGG + Intronic
985693856 5:1329035-1329057 CAGAGGCCCCCACCCACAGGTGG + Intronic
989317862 5:40103439-40103461 TTTAGTGGCCCACCCTCAGGGGG - Intergenic
991575440 5:68098727-68098749 CTAAGTGTCCCACCCTCTGAAGG + Intergenic
994572206 5:101529255-101529277 CGGAGGGTCCCACGCCCATGGGG + Intergenic
998139692 5:139692939-139692961 CTGGGGGTCCAAGACTCAGGAGG + Intergenic
998850076 5:146343758-146343780 CTCAAAGTCCCACCCTCCGGAGG - Intergenic
1002466522 5:179411466-179411488 CTGAGGACCCCACCCTCAGTTGG - Intergenic
1002470144 5:179430175-179430197 CTGACAGGCCCACCCTGAGGTGG - Intergenic
1005918964 6:30381806-30381828 CTGAGTGTCCCACACCCATGGGG - Intergenic
1006193637 6:32223963-32223985 CTGAGGGTCCCTGCCTGAAGAGG - Exonic
1006298438 6:33180449-33180471 CTGAGTCTCCCACCCCCATGGGG + Intronic
1007282814 6:40724875-40724897 CTGAGGTCCCCAAACTCAGGTGG - Intergenic
1010574075 6:77510734-77510756 CTGAGGTGGCCACCTTCAGGAGG + Intergenic
1010711400 6:79179413-79179435 ATGAGGGTTCCACCCTCATGAGG + Intergenic
1012814700 6:104008480-104008502 CTGAGGGTCACACAGTCAGTAGG - Intergenic
1018880207 6:167870490-167870512 CTGAGGGTTCCTACCTTAGGAGG - Exonic
1019706039 7:2497822-2497844 CTGAGGGAGTCACCCACAGGAGG + Intergenic
1020098374 7:5380889-5380911 GTGAGGGTGGCCCCCTCAGGTGG - Intronic
1020305964 7:6835052-6835074 CTGAGGGTTTCATCGTCAGGTGG - Intergenic
1020312552 7:6879850-6879872 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1020934655 7:14447171-14447193 CTGTGGGTTCCACCCTGATGGGG - Intronic
1021764454 7:23932756-23932778 CTGGGGGTCTCTGCCTCAGGGGG + Intergenic
1022221902 7:28321847-28321869 CACAGGGTCCCACACTCAGAAGG - Intronic
1025023364 7:55497031-55497053 CTGAGGCTCCCGCCCACAGGAGG + Intronic
1029667576 7:102005724-102005746 CTGAGAGCCCCAGCCTCAGCAGG - Intronic
1033421133 7:141205513-141205535 CTGAGGGGCCCTCCCTCTGGAGG + Intronic
1034532133 7:151702448-151702470 CTGAGAGTCCCACCCACAGAGGG + Intronic
1035242587 7:157542014-157542036 CCCCGGGTCCCACCCTGAGGTGG - Intronic
1035268300 7:157704516-157704538 CTGAAGGTCCCACCCTCGGCTGG + Intronic
1036390264 8:8318797-8318819 CTGAGAGTGCCACCAGCAGGCGG + Exonic
1036818496 8:11920051-11920073 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1036904485 8:12696523-12696545 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1040095135 8:43435444-43435466 CTGAAGTGGCCACCCTCAGGAGG - Intergenic
1042873549 8:73419711-73419733 TTGAGGGTCTAAACCTCAGGTGG + Intergenic
1047358396 8:124144843-124144865 CTGAGGTCCCTTCCCTCAGGGGG - Intergenic
1047510137 8:125509598-125509620 CACAGGGTCCCACACTCAGAAGG + Intergenic
1049530911 8:143154537-143154559 CTGAGGGGCCCACAGCCAGGTGG + Intergenic
1049567572 8:143349049-143349071 CTGAGGATCCTCTCCTCAGGAGG + Intronic
1050157439 9:2682241-2682263 CTCAGTGTCCCACCCACAGCAGG - Intergenic
1053281662 9:36824212-36824234 CTGAGGGACACAGCCTCAGGAGG + Intergenic
1055571762 9:77623973-77623995 CAGAGGATCCCACCCTCATGGGG + Intronic
1055810920 9:80146823-80146845 CTGAGGCTACCAGCCTCTGGAGG + Intergenic
1056832128 9:89925482-89925504 CTGAGGGTCCCAGGTTCAGGAGG - Intergenic
1056915508 9:90742731-90742753 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1061191753 9:129086309-129086331 CTGATGGCCCCACCCACAGGAGG - Intronic
1062005508 9:134236670-134236692 CACAGGGTCCCACCCTCACCGGG - Intergenic
1062056123 9:134470511-134470533 AGGAGGGTCCCAGGCTCAGGAGG - Intergenic
1062056175 9:134470705-134470727 AGGAGGGTCCCAGGCTCAGGAGG - Intergenic
1062056527 9:134471977-134471999 AGGAGGGTCCCAGGCTCAGGAGG - Intergenic
1062236863 9:135514534-135514556 CTGAGGGTGCCACGCTGGGGGGG - Intergenic
1062278198 9:135740461-135740483 CAGAGGGTCCCTCCCTCTCGAGG + Intronic
1062587240 9:137254921-137254943 CGGAGGAACCCACGCTCAGGAGG + Intergenic
1191174248 X:57482553-57482575 CAGTGGGTCCAACCCACAGGAGG - Intronic
1192440036 X:71167537-71167559 CTGAGGGCTCCACCCACTGGTGG - Exonic
1195690751 X:107622655-107622677 CAGAGAGTCCCACACTCAGAGGG - Intergenic
1197355973 X:125437716-125437738 CTGAGGTGGCCACCCTCAGGAGG + Intergenic
1199763830 X:150926133-150926155 CTGGGCTGCCCACCCTCAGGAGG - Intergenic
1202067072 Y:20951062-20951084 CTAAGGTGGCCACCCTCAGGAGG + Intergenic