ID: 1083675453

View in Genome Browser
Species Human (GRCh38)
Location 11:64322562-64322584
Sequence CCCTCTCCCTGTCCATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083675453_1083675460 18 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675460 11:64322603-64322625 CTCATTCCAGGAGGGCTCCCTGG No data
1083675453_1083675459 10 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675459 11:64322595-64322617 AGCACTTGCTCATTCCAGGAGGG No data
1083675453_1083675461 19 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675461 11:64322604-64322626 TCATTCCAGGAGGGCTCCCTGGG No data
1083675453_1083675462 20 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675462 11:64322605-64322627 CATTCCAGGAGGGCTCCCTGGGG No data
1083675453_1083675458 9 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675458 11:64322594-64322616 CAGCACTTGCTCATTCCAGGAGG No data
1083675453_1083675457 6 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675457 11:64322591-64322613 GCACAGCACTTGCTCATTCCAGG No data
1083675453_1083675463 21 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675463 11:64322606-64322628 ATTCCAGGAGGGCTCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083675453 Original CRISPR CCCTCTCCCTGTCCATCAGA TGG (reversed) Intergenic
No off target data available for this crispr