ID: 1083675458

View in Genome Browser
Species Human (GRCh38)
Location 11:64322594-64322616
Sequence CAGCACTTGCTCATTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083675453_1083675458 9 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675458 11:64322594-64322616 CAGCACTTGCTCATTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083675458 Original CRISPR CAGCACTTGCTCATTCCAGG AGG Intergenic
No off target data available for this crispr