ID: 1083675459

View in Genome Browser
Species Human (GRCh38)
Location 11:64322595-64322617
Sequence AGCACTTGCTCATTCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083675453_1083675459 10 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675459 11:64322595-64322617 AGCACTTGCTCATTCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083675459 Original CRISPR AGCACTTGCTCATTCCAGGA GGG Intergenic
No off target data available for this crispr