ID: 1083675462

View in Genome Browser
Species Human (GRCh38)
Location 11:64322605-64322627
Sequence CATTCCAGGAGGGCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083675453_1083675462 20 Left 1083675453 11:64322562-64322584 CCATCTGATGGACAGGGAGAGGG No data
Right 1083675462 11:64322605-64322627 CATTCCAGGAGGGCTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083675462 Original CRISPR CATTCCAGGAGGGCTCCCTG GGG Intergenic
No off target data available for this crispr