ID: 1083678814

View in Genome Browser
Species Human (GRCh38)
Location 11:64342100-64342122
Sequence CCGCAGCTGAGCCTTGGCGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083678814_1083678819 13 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678819 11:64342136-64342158 AGCTGTGAGTGTGCGCAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 186
1083678814_1083678822 19 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678822 11:64342142-64342164 GAGTGTGCGCAGCCTGGGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 252
1083678814_1083678821 18 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678821 11:64342141-64342163 TGAGTGTGCGCAGCCTGGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 228
1083678814_1083678818 -10 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678818 11:64342113-64342135 TCAGCTGCGGCGTCTGCGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 176
1083678814_1083678823 20 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678823 11:64342143-64342165 AGTGTGCGCAGCCTGGGAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 218
1083678814_1083678824 29 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678824 11:64342152-64342174 AGCCTGGGAAGGGGACTGAGTGG 0: 1
1: 0
2: 10
3: 122
4: 892
1083678814_1083678820 14 Left 1083678814 11:64342100-64342122 CCAACGCCAAGGCTCAGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1083678820 11:64342137-64342159 GCTGTGAGTGTGCGCAGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083678814 Original CRISPR CCGCAGCTGAGCCTTGGCGT TGG (reversed) Exonic