ID: 1083681092

View in Genome Browser
Species Human (GRCh38)
Location 11:64352215-64352237
Sequence AGTCCCAGGAGGAGACCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083681081_1083681092 21 Left 1083681081 11:64352171-64352193 CCGGAAGCTGGAGGTGCTGGAGG 0: 1
1: 1
2: 5
3: 80
4: 538
Right 1083681092 11:64352215-64352237 AGTCCCAGGAGGAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083681092 Original CRISPR AGTCCCAGGAGGAGACCCGC GGG Exonic
900097129 1:944395-944417 AGTTCCAGGGGGAGGCCTGCAGG - Exonic
900389721 1:2428706-2428728 CGTCCCAGCCGGAGACCGGCAGG - Intronic
901007215 1:6177988-6178010 AGGCCCTGGAGGGGACCGGCAGG + Intronic
901292308 1:8133481-8133503 AGTCTCAGGAGGAGAACAGAGGG - Intergenic
903044193 1:20553438-20553460 AGACCCAGGCGAAGACGCGCGGG - Exonic
903543700 1:24110822-24110844 TGGCCCAGGAGGAGAGCTGCTGG + Intronic
904790128 1:33013574-33013596 ACTCCCAGGAGCAGAGCAGCTGG + Intronic
904984309 1:34532263-34532285 AGTCCCAGGAACAGAGCTGCAGG + Intergenic
905941978 1:41870754-41870776 AGTCCCAGGATAACACCTGCAGG - Intronic
906206676 1:43990963-43990985 AGCCCCAGGAGGGGACCAGAGGG + Exonic
907844915 1:58196295-58196317 GGTCCCAGGAGGAAACAGGCTGG + Intronic
912442825 1:109712230-109712252 AGGCCCAGGAGGGGACAGGCGGG - Intergenic
915880076 1:159660495-159660517 AGTGCCAGGAGGGGAACCGGTGG + Intergenic
918995390 1:191752395-191752417 AGTCGAAGGAGGAGCCCAGCAGG + Intergenic
919775105 1:201189326-201189348 AGTCCCAGGAGAACACCCTAGGG - Intergenic
919857674 1:201716909-201716931 AGGGCCAGGAGGGGAGCCGCTGG + Intronic
919870828 1:201820031-201820053 AGCCCCAGGAGGAGAACAGGAGG + Exonic
922080403 1:222290366-222290388 AGGCACAGGAGGAGACCATCAGG + Intergenic
922740964 1:228014032-228014054 GGTCCCAGGAGGCGACCAGCTGG + Intronic
924624820 1:245689024-245689046 TGTCCCCGGCGGAGCCCCGCGGG - Intronic
1065804605 10:29383026-29383048 AGTCACAGCAGGAGACCAGGTGG + Intergenic
1065847788 10:29760717-29760739 AATCCCAGGATGAGGCCCTCAGG + Intergenic
1065944528 10:30594706-30594728 AGTCACAGCAGGAGACCAGGTGG - Intergenic
1069970567 10:72164643-72164665 ATACCCAGGAGGAGAACTGCTGG + Intronic
1071488679 10:86121176-86121198 AGGCCCAGGAGGAGACTTCCTGG - Intronic
1075522986 10:123155004-123155026 TGTCCCAGGAGGAGACAAGCAGG - Exonic
1076746490 10:132517324-132517346 AGGCCCAGGGGGAGGCCAGCAGG - Intergenic
1076794371 10:132791512-132791534 CCTCCCAGGAGGACACCCGGGGG + Intergenic
1077117803 11:893208-893230 AGTCCCAGGGGCAGACCTGGGGG - Intronic
1078527467 11:12111355-12111377 AGGCCCAGGAGCACCCCCGCAGG + Intronic
1080727897 11:34916178-34916200 ATTCCCAGGAGGAGAGGCCCAGG - Intronic
1082825130 11:57571899-57571921 AGTCCCAGGAGGGGAGCTGGGGG + Intergenic
1083277959 11:61608149-61608171 ATTCCCAGGAGTGGAACCGCCGG + Intergenic
1083681092 11:64352215-64352237 AGTCCCAGGAGGAGACCCGCGGG + Exonic
1083922351 11:65787620-65787642 AGTCCCGGGTCGAGAGCCGCGGG - Intronic
1084317466 11:68353830-68353852 AGTCTCAGGAGGGGCCCCCCTGG - Intronic
1084531290 11:69729397-69729419 AGTCTCAGAGGGAGACCAGCGGG - Intergenic
1084935391 11:72584121-72584143 AGTCGGAGGAGGAGAACCGAGGG + Intronic
1085413678 11:76306578-76306600 AGTCACAGCAGGAGAGCTGCCGG + Intergenic
1085424000 11:76386896-76386918 AGTCCTTGGAGGGGACCCACTGG - Intronic
1089601377 11:119617455-119617477 GGTCCCAGGCGGAACCCCGCCGG + Intergenic
1089659751 11:119978211-119978233 AGTCCCGGGAGGAGAGCCCCTGG + Intergenic
1090330117 11:125924780-125924802 CGTCCCAGCGGGAGACCCTCAGG + Intergenic
1091948928 12:4575102-4575124 ATTCCCAGGAGGGGAACCGCTGG + Intronic
1094807451 12:34107065-34107087 AGTCCCAGGGCGAGACACCCAGG - Intergenic
1096868602 12:54579382-54579404 AGGCCCAGGAGGAGGCCCCGAGG + Exonic
1104512807 12:129396566-129396588 AGAGACTGGAGGAGACCCGCAGG + Intronic
1104984424 12:132588601-132588623 ATTGCCAGGAGGAGCCCAGCAGG - Intergenic
1105426979 13:20302355-20302377 AGGCCCAGGAGGAGCCCTCCCGG - Intergenic
1108501336 13:51072370-51072392 AGGACCAGGAGGAGACCAGGAGG - Intergenic
1109404905 13:61885362-61885384 AGTCCCAGTTGGAGAGCTGCAGG + Intergenic
1112202273 13:97288561-97288583 AGTCCCAGGGGCATGCCCGCTGG - Intronic
1112723109 13:102269178-102269200 AGTCCTAGGTGGAGACCAACTGG + Intronic
1113891482 13:113737854-113737876 AGGCACAGGAGGAGGCCCGTGGG + Intergenic
1116870568 14:50065903-50065925 ATTCCCAGGAGGAGACAGGAGGG + Intergenic
1121292068 14:92784137-92784159 AGTCCCTGGAGGAAGCCTGCAGG + Intergenic
1121511203 14:94514654-94514676 AGTCCCTGGAATAGACCCACTGG - Intronic
1124626050 15:31308127-31308149 AGTCCCAGCAGGAGATCCCCGGG - Intergenic
1126405476 15:48318309-48318331 AGCCCCAGCAGGAGACCAGAGGG - Intergenic
1130310553 15:82750265-82750287 ATTCCCCGGAGGACATCCGCGGG + Intergenic
1131308134 15:91264015-91264037 TGTCCCAGGAGCAGTCCTGCTGG + Intronic
1132551590 16:555954-555976 AGACCCAGGAGGAGATGCGGGGG - Intergenic
1132854099 16:2037140-2037162 CGACCCAGGATGAGACCCACAGG - Intronic
1133874505 16:9721060-9721082 AATCCCAGCAGGACACCCGTGGG + Intergenic
1135400283 16:22162356-22162378 TCTCTCAGGTGGAGACCCGCGGG - Intergenic
1137225733 16:46506599-46506621 AGACCTAGGAGGAGTCCTGCCGG - Intergenic
1138526988 16:57614558-57614580 GGTCCCAGAAAGAGACCTGCGGG + Intronic
1138535331 16:57657010-57657032 AGCCCCAGGTGGATACCCACAGG - Intronic
1141120396 16:81350462-81350484 ACTCCCAGGAGTAGACCCAAGGG + Intronic
1141592359 16:85077339-85077361 AGGCCCAGAGGGAGCCCCGCAGG - Intronic
1141605001 16:85147679-85147701 AGTCCCAGGATGACAGCTGCAGG - Intergenic
1141828884 16:86498600-86498622 AGTCCCGGCGGGAGACGCGCGGG + Intergenic
1143622307 17:8087658-8087680 AGGCCCAGGCGGAGCCCAGCTGG + Exonic
1143692275 17:8579010-8579032 AGTCCCAGGATGAGCCCCTGTGG - Intronic
1144950119 17:18989422-18989444 AGGCCCAGGAGGAGCCCAGATGG - Intronic
1147338879 17:39742360-39742382 AGTCCCAGGAGGGGTCCCAGGGG - Exonic
1147374833 17:40017244-40017266 GGTCCCAGGTGGGGACCCTCAGG - Exonic
1147543567 17:41381092-41381114 AGTCCCAGGTGGAGTCCCTGAGG - Exonic
1148789970 17:50167532-50167554 AGTCACAGCAGGAGCCCTGCGGG - Intronic
1148992235 17:51676295-51676317 AGAGCCAGGAGGAGACCAGAGGG + Intronic
1150821035 17:68434504-68434526 AGTCCCCGCAGAAGTCCCGCAGG - Intronic
1152457838 17:80426288-80426310 AGTCTTAGGAAGAGACCCGCTGG + Intronic
1153491680 18:5655933-5655955 ATCTCCAGGAGGAGACCAGCAGG - Intergenic
1154317891 18:13320442-13320464 AGTCCCAGGGGGAGAGCAGCAGG - Intronic
1154960900 18:21307731-21307753 AGCCCCAGCAGGAGACTCGGGGG + Intronic
1158293084 18:55963621-55963643 AGGCCAAGGAGGAGACAAGCGGG - Intergenic
1158357622 18:56638564-56638586 AGTCCCGGGAGAAGACTCGGCGG - Exonic
1160083799 18:75755150-75755172 AATCTCTGGAGGAGACCAGCAGG + Intergenic
1163620637 19:18357769-18357791 AGTCCCAGGAGCAGAACCAACGG - Intronic
1166113981 19:40641524-40641546 AGTCCAGGGAGGAGGCCGGCCGG + Intergenic
1166569340 19:43783976-43783998 AGACCCAAGAGGAGACCAGGAGG - Intergenic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
927125957 2:20012594-20012616 AGTCCCGGGAGGCGGCGCGCGGG + Exonic
931707345 2:64958096-64958118 AGTCCCAGGAGGATACTCCAAGG - Intergenic
934079191 2:88452731-88452753 CGGCCCAGGAGGAGCCGCGCCGG - Intergenic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
937224700 2:120361691-120361713 AGTCCCAGGAGGAGGACAGAAGG - Intergenic
938303479 2:130231877-130231899 AGTTCCAGGGGGAGGCCTGCAGG + Intergenic
938342089 2:130542373-130542395 GGTCCCAGGAGGACTCCTGCAGG - Intronic
938347743 2:130578338-130578360 GGTCCCAGGAGGACTCCTGCAGG + Intronic
938453200 2:131442379-131442401 AGTTCCAGGGGGAGGCCTGCAGG - Intergenic
940251233 2:151679019-151679041 AGCAGCAAGAGGAGACCCGCAGG + Intronic
943046484 2:182867131-182867153 ACGCTCAGGAGGAGCCCCGCAGG + Exonic
945018835 2:205550349-205550371 GTTTCCATGAGGAGACCCGCTGG + Intronic
945059064 2:205892738-205892760 TGTGCCAGGAGGGGACCTGCTGG + Intergenic
948642647 2:239385363-239385385 AGTCCTCGGAGGTGACCCGGAGG - Intronic
1169132108 20:3171680-3171702 AATCCCAGCAGGACACCGGCAGG + Intronic
1171416100 20:24981525-24981547 AGGGCCAACAGGAGACCCGCTGG - Intronic
1174741158 20:53015495-53015517 AGTGCCAGGATGAGAACCCCAGG + Intronic
1176127452 20:63482350-63482372 TGTCCCTGCAGGAGGCCCGCAGG + Intergenic
1176241123 20:64076446-64076468 AGACCCAGGAGGGGACCCAGTGG - Intronic
1176548996 21:8213504-8213526 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1176567925 21:8396534-8396556 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1176575829 21:8440753-8440775 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1179561904 21:42220597-42220619 AGCCCGAGCGGGAGACCCGCAGG + Intronic
1179912309 21:44456677-44456699 ACTCCCGGGTGGAGACCAGCAGG - Exonic
1180784538 22:18539472-18539494 AGGCCAAGGAGGAGCCCAGCAGG + Intergenic
1181128115 22:20713525-20713547 AGGCCAAGGAGGAGCCCAGCAGG + Intronic
1181241441 22:21478829-21478851 AGGCCAAGGAGGAGCCCAGCAGG + Intergenic
1182112295 22:27732423-27732445 TGTCCCAGGAAGGGACCTGCAGG - Intergenic
1182779083 22:32853003-32853025 GGTCCCATGGGGAGACCCGCTGG + Intronic
1203253880 22_KI270733v1_random:129811-129833 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1203261936 22_KI270733v1_random:174890-174912 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
950463510 3:13139518-13139540 AGTAGCAGGATGAGACCTGCAGG - Intergenic
950822424 3:15775387-15775409 ATTCCCCGGAGGACACCAGCTGG + Intronic
953860573 3:46540837-46540859 AGTTCCAGGAGGCAACCCTCTGG - Intronic
954832730 3:53436345-53436367 AGTACAAGGAGCAGACCCCCGGG - Intergenic
961358190 3:126352003-126352025 TGGCCCATGAGGAGACCGGCAGG + Exonic
968271798 3:197408665-197408687 AGCCCGGAGAGGAGACCCGCAGG - Intergenic
968941812 4:3642987-3643009 TGTCCCAGCAGGAGACCACCCGG - Intergenic
970561445 4:17285400-17285422 AATGCCAGGAGGAGTCCAGCGGG + Intergenic
978529517 4:109700027-109700049 AGCCACAGGAGGTGAGCCGCTGG - Intronic
979890846 4:126092026-126092048 AGTCACAGGAGAAGAGCAGCAGG - Intergenic
983317043 4:166145712-166145734 ACTCCCAGGAGGGGACCCTAGGG + Intergenic
992795650 5:80253245-80253267 AGTCCCAGGAGGAGACAGCGTGG - Intronic
998312169 5:141144455-141144477 AGTCCCAGAAGGAGGCCAGAAGG + Intronic
1002254050 5:177945746-177945768 AGGCCCAGGTGCAGACACGCAGG - Intergenic
1002708923 5:181182423-181182445 AGTTCCTGGAGGAGGCCCTCAGG + Intergenic
1002857490 6:1051130-1051152 AGTGGAAGGAGCAGACCCGCTGG + Intergenic
1006794211 6:36721747-36721769 AGCCCCAGGCTGAGCCCCGCTGG - Exonic
1007702662 6:43773720-43773742 AAACCCAGGAGGAGACCCTGGGG - Intronic
1017196665 6:151708432-151708454 AGTCCCAGGAGTAGAATTGCTGG + Intronic
1017717303 6:157222026-157222048 CCTCCCAGGAAGAGACCCACAGG - Intergenic
1022948628 7:35314591-35314613 AGTTCCAGGAGGAGAGTCACAGG + Intergenic
1034881797 7:154768199-154768221 GGCACCAGGAGGAGACCAGCTGG - Intronic
1037438157 8:18886456-18886478 CGTCCCAGTAGGAGACCCCTGGG - Intronic
1037513196 8:19604231-19604253 AATTCCAGGAGGTGACCTGCAGG + Intronic
1037522680 8:19695364-19695386 AGACCCAGGATGAGACCCACAGG - Intronic
1040388907 8:46933239-46933261 TGTCCCAGGAAGAGTCCCCCTGG + Intergenic
1042546218 8:69953963-69953985 AGGCCCAGCAGGACCCCCGCGGG + Intergenic
1048970434 8:139642512-139642534 AGTCCCTGGAGGCTGCCCGCAGG + Intronic
1049419380 8:142510317-142510339 TGTCCCAGGAGATGAGCCGCAGG + Intronic
1049512753 8:143038010-143038032 AGCCCCAGCAGGAGCCCAGCAGG + Intergenic
1050623736 9:7481611-7481633 AGTTCCAGGAGCAGACCCTGGGG + Intergenic
1056773814 9:89497707-89497729 CGTCCCAGGAGGGGCCCCGGGGG + Intronic
1057076667 9:92141661-92141683 AGTACCAGGTGGAGACAGGCGGG - Intergenic
1059398745 9:114055238-114055260 GGTCCTAGGCGGAGACCGGCTGG - Exonic
1060918419 9:127404603-127404625 AGTTCCCGGAGCAGACCCTCTGG - Intronic
1061017287 9:127989223-127989245 AGTCCCAGGCTGAGGCCTGCTGG - Intergenic
1061117976 9:128626644-128626666 AGGCCCTGGAGGAGACCTGGAGG + Exonic
1062374201 9:136254664-136254686 TGTCCAAGGAGGAGCCACGCAGG + Intergenic
1062478557 9:136741325-136741347 AGTCCCAGGAGGTGATCCTGAGG - Exonic
1203470280 Un_GL000220v1:112955-112977 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1203478101 Un_GL000220v1:156927-156949 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1185695171 X:2188702-2188724 AATCCAAGAAGGAGAGCCGCGGG + Intergenic
1186897138 X:14014928-14014950 AGTCAAAGGAGGAGCACCGCGGG - Intronic