ID: 1083681604

View in Genome Browser
Species Human (GRCh38)
Location 11:64354169-64354191
Sequence AGGTGGGTCTGGGGGTCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 2, 2: 4, 3: 91, 4: 799}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083681584_1083681604 21 Left 1083681584 11:64354125-64354147 CCCCCGGAGACGGAGCTTCCTGA 0: 1
1: 0
2: 0
3: 17
4: 546
Right 1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG 0: 1
1: 2
2: 4
3: 91
4: 799
1083681593_1083681604 3 Left 1083681593 11:64354143-64354165 CCTGAGGGCAGGGAGGCAGATGG 0: 1
1: 0
2: 4
3: 95
4: 673
Right 1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG 0: 1
1: 2
2: 4
3: 91
4: 799
1083681588_1083681604 18 Left 1083681588 11:64354128-64354150 CCGGAGACGGAGCTTCCTGAGGG 0: 1
1: 0
2: 2
3: 73
4: 458
Right 1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG 0: 1
1: 2
2: 4
3: 91
4: 799
1083681586_1083681604 19 Left 1083681586 11:64354127-64354149 CCCGGAGACGGAGCTTCCTGAGG 0: 1
1: 0
2: 2
3: 71
4: 2138
Right 1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG 0: 1
1: 2
2: 4
3: 91
4: 799
1083681583_1083681604 22 Left 1083681583 11:64354124-64354146 CCCCCCGGAGACGGAGCTTCCTG 0: 1
1: 0
2: 3
3: 18
4: 539
Right 1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG 0: 1
1: 2
2: 4
3: 91
4: 799
1083681585_1083681604 20 Left 1083681585 11:64354126-64354148 CCCCGGAGACGGAGCTTCCTGAG 0: 1
1: 0
2: 2
3: 393
4: 3409
Right 1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG 0: 1
1: 2
2: 4
3: 91
4: 799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083681604 Original CRISPR AGGTGGGTCTGGGGGTCAGG TGG Exonic
900078119 1:834374-834396 AGCTGGGTGTGGAGATCAGGGGG + Intergenic
900120496 1:1046722-1046744 GGGTGGCTCTGGGGGTGAGCAGG + Exonic
900203630 1:1421876-1421898 AGGTGGGGGCGGGGGTCGGGGGG + Intergenic
900214404 1:1473718-1473740 GGGTGGATCACGGGGTCAGGTGG - Intronic
900303315 1:1988843-1988865 AGGTGGGTGTGGGGGGGTGGGGG - Intronic
900388260 1:2420369-2420391 AGGTGGGTGTGGGGGCCTGTGGG + Intergenic
900698052 1:4024498-4024520 AGGTGGGGCTGGTGATTAGGAGG + Intergenic
900846353 1:5105025-5105047 AGGTGGGGCTGGGGGCCTAGTGG + Intergenic
901241772 1:7698472-7698494 AGGTAGTTCTGGGGGGCAAGGGG + Intronic
901605687 1:10457356-10457378 AGGTCGGTCTGTCGGTCATGTGG + Exonic
901638609 1:10681868-10681890 AGGTGAGCCTGGGGCTCAAGAGG - Intronic
901935451 1:12623128-12623150 GGGTGGGGCTGGGGCTGAGGGGG + Intergenic
902246574 1:15124709-15124731 AGGCGGGGTTGGGGGTGAGGTGG - Intergenic
902903105 1:19533827-19533849 GGGTGAGGCTGGGGGTCAAGTGG + Intergenic
903283125 1:22261542-22261564 GGGTGGGGCTGAGGGACAGGAGG + Intergenic
903308839 1:22436283-22436305 AGGTGGATCACGAGGTCAGGAGG + Intergenic
903329123 1:22588259-22588281 ACGTGGGGCTGGGGGTCTGAGGG - Intronic
903470647 1:23584956-23584978 AGGTGGATCACGAGGTCAGGAGG - Intronic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
903866060 1:26398702-26398724 ATGGGGGTGTGGGGGGCAGGGGG + Intergenic
903974394 1:27139643-27139665 AGGCGTGTTTGGGGGTGAGGTGG + Intronic
904095145 1:27971216-27971238 AGGTGTGTCTTGGGTTGAGGAGG - Exonic
905016234 1:34780778-34780800 AGGTGGGTCTGCGGCTGGGGTGG - Intronic
905923249 1:41732840-41732862 AGATGGGACTGGGGGTCGGTAGG + Intronic
905952201 1:41961299-41961321 ATGTGGGTCAGGGATTCAGGTGG - Intronic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906210460 1:44009984-44010006 AGGGGTGCCTGGGGGTCTGGAGG - Exonic
906326662 1:44850431-44850453 GGGTGGGGCTGTGGGTGAGGTGG + Intergenic
906396501 1:45471004-45471026 AGGTGGATCACGAGGTCAGGAGG + Intronic
906423378 1:45688729-45688751 ATTTTGGTCTGGGGCTCAGGTGG + Intronic
906572653 1:46857438-46857460 AGGTGGGTCTGGCGGATATGAGG + Intergenic
906599122 1:47108453-47108475 AGGTGGGTCTGGCGGATATGAGG - Intronic
906784563 1:48603243-48603265 AGGTGGATCATGAGGTCAGGAGG + Intronic
907272340 1:53298358-53298380 AGGTGGGTATGGGGGAGAGGTGG + Intronic
907290842 1:53411898-53411920 AGATGGGTCAGGGAGTCAGTGGG + Intergenic
907429262 1:54402513-54402535 GGGTGGGAGTGGGGGTGAGGTGG - Intronic
907841297 1:58160180-58160202 AGGTAGGCCAGGGGGTAAGGAGG + Intronic
907973055 1:59403585-59403607 AGGTGGGTATGGGGGCCACCTGG + Intronic
909235109 1:73143121-73143143 AGGTGGGGTTGGGGGTCACAAGG + Intergenic
909600488 1:77456490-77456512 AGCTTGGGCTGGGGCTCAGGGGG + Intronic
910112086 1:83693490-83693512 AGGGGGGTGGGGGGGTGAGGAGG + Intergenic
910498275 1:87858117-87858139 AGGTGGATCACGGGGTCAGGAGG + Intergenic
912480036 1:109976189-109976211 AGGTAGAGCTGGGGGTGAGGGGG + Intergenic
912960292 1:114190050-114190072 AGGTAGGGCAGGGTGTCAGGTGG - Intergenic
913366677 1:118047452-118047474 AGGTGGGCCTGGCAGTGAGGTGG - Intronic
914333808 1:146697476-146697498 AGGAGAGTCTGGGGGTGAGCAGG - Intergenic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915017309 1:152746023-152746045 AGGAGTGTGTGGGGGGCAGGAGG - Intronic
915283346 1:154837632-154837654 AAGTGGGTCTGGGGGTCCCTGGG + Intronic
915580712 1:156811497-156811519 AGGGAAGTCTGGGGGTGAGGAGG - Intronic
915601923 1:156927815-156927837 AGGTGGGTGTGCCGATCAGGTGG + Exonic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915615286 1:157033104-157033126 AGCTTGGGCTGGAGGTCAGGAGG - Intronic
915908867 1:159899987-159900009 AGTTGGGTCTAGGGGTCAGGAGG - Intronic
916076067 1:161200630-161200652 AGGTGGGTCTGGCAGTCACAAGG - Intronic
916174431 1:162025698-162025720 AAGTGGGCGTGGGAGTCAGGAGG + Intergenic
916204338 1:162300752-162300774 AGGTGGCTGTAGGGGGCAGGAGG - Intronic
916493807 1:165326930-165326952 GTGTGTGTCTGGGGGTGAGGGGG - Intronic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
917129927 1:171730731-171730753 TGGTGGTTCTGGGGGCAAGGAGG + Intronic
918398840 1:184143831-184143853 AGGTGGCTCTGGGGGTTCAGGGG + Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
918950133 1:191126100-191126122 AGGAGGGGCTGGCAGTCAGGAGG - Intergenic
920353901 1:205356400-205356422 AGGCTGGCATGGGGGTCAGGAGG - Intronic
920403457 1:205692063-205692085 TGGAGGGACTGGGGGGCAGGGGG - Intergenic
921049986 1:211504374-211504396 AGCTTGGTCTGGGGGTTTGGTGG - Intergenic
921287550 1:213622665-213622687 AAGTGCCTATGGGGGTCAGGGGG - Intergenic
921974832 1:221191266-221191288 TGGGGGGTGGGGGGGTCAGGGGG - Intergenic
922463903 1:225833567-225833589 AGGTGGATCACGAGGTCAGGAGG + Intronic
922502434 1:226107349-226107371 AGGTGGATCACGAGGTCAGGAGG - Intergenic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
922803965 1:228376335-228376357 GGGGGGGCCTGGGGGTGAGGCGG - Intronic
923046954 1:230362526-230362548 AAGCTGGCCTGGGGGTCAGGAGG - Intronic
923126838 1:231040472-231040494 AGGTGAGTCGGGGGGTTAGAGGG - Intergenic
924821338 1:247493550-247493572 ATGTGGGTTGGGGGGTGAGGTGG + Intergenic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1062843666 10:689331-689353 CGCGGGGTCTGGGGGTCCGGGGG + Intronic
1063188712 10:3673042-3673064 AGGTGGATCATGAGGTCAGGAGG + Intergenic
1063227935 10:4033809-4033831 GGGTGGGCCTGGGAGGCAGGAGG + Intergenic
1063876003 10:10479391-10479413 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1064091892 10:12392798-12392820 ACCTGGGCCTGGGGGTCAGGGGG - Intronic
1064247288 10:13679195-13679217 AGGTGGGTCACGAGGTCAGGAGG + Intronic
1064299853 10:14113933-14113955 AGGATGGGCTGGGGGTGAGGTGG - Intronic
1064859848 10:19815815-19815837 AGGTGGGTGTGGGGCGCAGTTGG + Intergenic
1064885356 10:20105639-20105661 AGGTGGGGGTAGGGGGCAGGAGG - Intronic
1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG + Intergenic
1065583113 10:27191510-27191532 AGGTGGGGCGGGGGGAGAGGAGG + Intergenic
1066065740 10:31759813-31759835 AGGTGGATTTGGGGAGCAGGTGG + Intergenic
1066719108 10:38318895-38318917 AGGTGGGTCACGAGGTCAGTAGG + Intergenic
1067552504 10:47245590-47245612 GGGTGGGTGTGGGGGTCCTGGGG - Intergenic
1067753361 10:48986050-48986072 AGCTGGGCCTGGTGCTCAGGTGG - Intergenic
1067946594 10:50693231-50693253 CAGGGGGTCAGGGGGTCAGGGGG - Intergenic
1068077792 10:52278699-52278721 AGGTGGATCATGAGGTCAGGAGG + Intronic
1068517628 10:58044036-58044058 GGGTGGGTGTTGGGGGCAGGGGG + Intergenic
1068776509 10:60873515-60873537 GGGTGTGTATGGGGGTAAGGTGG + Intronic
1069624968 10:69861966-69861988 AAGTGGCTCTTGGGGTAAGGTGG + Intronic
1069655010 10:70081321-70081343 AGGTGTGTCGGGAGCTCAGGAGG + Intronic
1069717899 10:70532594-70532616 AGGGAGGTGTGGGGGTCAGAGGG - Intronic
1070771556 10:79085328-79085350 AGCTGGGGGTGGGGGTCAAGGGG + Intronic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1070923110 10:80201441-80201463 TGGTGGGTCTGGGGCTCAGGAGG - Intronic
1072573948 10:96682685-96682707 AGGTGAGGCTTGGGGTCAGTTGG - Intronic
1074926713 10:118080598-118080620 AGGTGGGGAAGGGTGTCAGGTGG - Intergenic
1075022443 10:118961603-118961625 AGGAGGGGCAGGGGGTCAGGTGG - Intergenic
1075040462 10:119103888-119103910 AGGTGGGCCTGCGGGTGGGGCGG + Intergenic
1075495540 10:122915862-122915884 AGGTGGGACTGGGTGTCCTGGGG - Intergenic
1075759112 10:124841800-124841822 AGGTGGATCGCGAGGTCAGGAGG - Intergenic
1075788555 10:125066974-125066996 ACCTGGGCCTGGTGGTCAGGCGG - Intronic
1075994552 10:126866713-126866735 AGGTGGATCATGAGGTCAGGAGG - Intergenic
1076065104 10:127442326-127442348 GGCTGGGTCTGGGGGCCTGGTGG - Intronic
1076137946 10:128057726-128057748 AGATGGGTCAGGAGGTCATGTGG + Intronic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1076774547 10:132687521-132687543 AGGTGGGTCTAGGGTGCAGCAGG - Intronic
1076873522 10:133205015-133205037 TGGTGATTCTGGGGGTGAGGAGG - Intronic
1077015640 11:398002-398024 AGGTGTGTGTGGGGGTATGGAGG - Intronic
1077052219 11:572059-572081 CGGTGGGGGTGGGAGTCAGGAGG + Intergenic
1077303421 11:1857303-1857325 AGGAGGGTCTGGGGTCCAGCTGG + Intronic
1077460194 11:2705257-2705279 TGGGGGGTCTGGAGTTCAGGCGG + Intronic
1077504103 11:2922297-2922319 GGGTGGGTGTGGGGGGCTGGAGG - Intronic
1077563498 11:3281193-3281215 AGGTGGCACTGGGGGCCATGTGG + Intergenic
1077569390 11:3327008-3327030 AGGTGGCACTGGGGGCCATGTGG + Intergenic
1078426118 11:11252793-11252815 AGGTCGGCCTGGGTGTCAGCGGG - Intergenic
1079935993 11:26616995-26617017 AGGTGGATCATGAGGTCAGGAGG - Intronic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080541060 11:33265857-33265879 GGGTGGGTCATGAGGTCAGGAGG + Intronic
1080598363 11:33797137-33797159 AGGTGGGGATGGGGGTGATGTGG + Intergenic
1081322635 11:41709743-41709765 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081660098 11:44882820-44882842 CCTTGGGTCTGGGGGTCTGGGGG - Intronic
1081691404 11:45080903-45080925 ACCTGGGGGTGGGGGTCAGGAGG - Intergenic
1081706907 11:45187580-45187602 AGGTGGGACTGGTGGCCTGGAGG + Intronic
1081857841 11:46315224-46315246 GGGTGGGGTGGGGGGTCAGGTGG - Intronic
1081932978 11:46885446-46885468 AGGTGGGTTTGGGAGGCAAGGGG - Intronic
1081967516 11:47178568-47178590 AGGTGCCTCTGGGGGTAGGGAGG - Intronic
1083306375 11:61764122-61764144 AGCTGGGGGTGGGGGTCAGCAGG + Intronic
1083614177 11:64018288-64018310 GGGGGGCTCTGGGGGTCAGGTGG + Intronic
1083615734 11:64025343-64025365 ATGGGGATCTGGGAGTCAGGGGG - Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083902478 11:65650327-65650349 AGCTGGGGCTGGGAGTCAGCTGG + Intronic
1084031775 11:66485286-66485308 AGGTGGGGATGGGGGGCTGGTGG + Intronic
1084182055 11:67451724-67451746 AGCTGGGTCTGTGGCTCAGTGGG + Exonic
1084288625 11:68147477-68147499 ACTTGGGGCTGGGGGCCAGGAGG + Intergenic
1084447574 11:69212688-69212710 AGGTGGGCCTGGTGGCAAGGTGG - Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084960214 11:72712565-72712587 GAGTGGGTCTCGGGGGCAGGAGG - Exonic
1085028967 11:73258233-73258255 ATGTGAGTATGGGGATCAGGCGG + Intergenic
1085278543 11:75315320-75315342 ATGTGGGTGTGGGGGTCAATGGG - Intronic
1085453922 11:76655257-76655279 AGGTGGGTGGGGGGGTGAGCTGG + Intergenic
1088595749 11:111439038-111439060 GGGTGGGTGTGCGGGACAGGGGG - Intronic
1088906734 11:114160836-114160858 AGGTGGTTTTGGGGGTCAGAAGG + Intronic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1089126939 11:116183110-116183132 AGATGGGTCTGGGGATCTGGAGG + Intergenic
1089382771 11:118047959-118047981 AGGTGTCTCTGGGGCTCAGATGG + Intergenic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090597796 11:128337814-128337836 AGGTGAGGCTGATGGTCAGGAGG + Intergenic
1090736525 11:129616151-129616173 ACGTGGGGCTGGGGCTCCGGGGG - Intergenic
1090804936 11:130196979-130197001 AGGTGGGCCTGAGGGACAGATGG - Intronic
1090857824 11:130625751-130625773 AGGCGGGACTGGGGCTCCGGTGG - Intergenic
1090936163 11:131344452-131344474 ATCTGAGTCTGGGGCTCAGGGGG + Intergenic
1091192862 11:133708793-133708815 AGGTGGGCCTGGGGCCAAGGTGG - Intergenic
1091555873 12:1573103-1573125 AGTTGGGTCTGTGGGTCCAGGGG + Intronic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1091857578 12:3752098-3752120 AGGGTGGTCAGAGGGTCAGGAGG - Intronic
1091990627 12:4952883-4952905 AGATGGGACTGGGGCTGAGGAGG - Intergenic
1092499490 12:9031393-9031415 AGGGAGGTCTGGGGCTCAGGAGG + Intergenic
1092895074 12:13002526-13002548 AGAAGGGTCTGGCTGTCAGGAGG - Intergenic
1093081901 12:14821994-14822016 AGGTGTGTGTGGGGGTGGGGTGG + Intronic
1093181002 12:15966892-15966914 AGGTGGTCCTGGTGCTCAGGAGG - Intronic
1095557386 12:43523456-43523478 AGGTGGGGGTGGGGGGCAAGTGG + Intronic
1095752670 12:45729257-45729279 AGGCGGGGCTGGGGGTGGGGAGG - Intergenic
1095948349 12:47766656-47766678 AGGTGGCCTGGGGGGTCAGGGGG - Intronic
1096117162 12:49061240-49061262 ACGGGGGACTGGGAGTCAGGAGG - Intergenic
1096195606 12:49647207-49647229 AGTGGGGGCTGGGGGTCAGAAGG - Intronic
1097001916 12:55884168-55884190 AGGTGGGTGTTTGGGTCATGCGG - Intergenic
1097020320 12:56016213-56016235 AGGTAGGGGTGGGGGTGAGGGGG - Intronic
1098310150 12:69140412-69140434 AGGGAGGTCTGGGGCTCAGGAGG - Intergenic
1099050698 12:77778384-77778406 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1100055208 12:90500930-90500952 AGGTGGATCATGAGGTCAGGAGG - Intergenic
1101103721 12:101420264-101420286 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1101394986 12:104338940-104338962 AGGTGGATCACGAGGTCAGGAGG - Intronic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1101606119 12:106248319-106248341 AGGTGGGGCTGGCGGCCCGGCGG + Intronic
1101718761 12:107333213-107333235 AGGAGGGTCTTAGGGTCAGAAGG + Intronic
1101821802 12:108190367-108190389 TGGGTGGTCTGGGGGTCAGTTGG + Intronic
1101966804 12:109287460-109287482 ACGTGGGGCTGGGGGTAGGGGGG + Exonic
1101988240 12:109463996-109464018 AGGCTGCTCTGGGGGTCAGGAGG + Intronic
1102141359 12:110617863-110617885 AGGTGGATCACGAGGTCAGGAGG - Intronic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102877327 12:116458534-116458556 AGGTGGGGATGGGGGTATGGGGG - Intergenic
1103886591 12:124207033-124207055 GGGTGGGTTTGGGGCTGAGGAGG + Intronic
1103908521 12:124339599-124339621 AGGTGGGTAGGTGGGTCAGTGGG - Intronic
1103908580 12:124339809-124339831 AGGTGGGTGTGTGGGTCAGTGGG - Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104014596 12:124953546-124953568 AGAAGGGTCTGGGGGACATGTGG + Intronic
1104104141 12:125643075-125643097 ACGTGTGTCTGGGGCTCAGAAGG + Intronic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104548159 12:129731390-129731412 AAGAGGGTATGGGGGACAGGGGG + Intronic
1104918349 12:132278002-132278024 GGGTGGGTGTGGGAGTGAGGGGG - Intronic
1104945075 12:132412117-132412139 TGGGGAGTCTGGGGGCCAGGGGG + Intergenic
1104968805 12:132521919-132521941 GGGCGGGTCTGGGGAGCAGGTGG + Intronic
1106057821 13:26254596-26254618 AGCTGGGTCGGGGGGCCGGGGGG - Exonic
1106340090 13:28819747-28819769 AGCTGGGGCTGGGGCTGAGGCGG + Intergenic
1106879811 13:34116884-34116906 AGGTGGGTAGAGGAGTCAGGAGG - Intergenic
1107246431 13:38301798-38301820 AGGAGGTTCTGGGGGTCAAATGG - Intergenic
1108287153 13:48919793-48919815 AGGTGGGGTTGGGGGACAGTGGG + Intergenic
1108934298 13:55866919-55866941 AGGTGATTCTGGAGGTCAGAGGG - Intergenic
1110422526 13:75329108-75329130 AGGTGTGTGTGGGGGTTGGGGGG - Intronic
1112265548 13:97920224-97920246 CGGTGGGAGTGGGGGACAGGGGG - Intergenic
1112570486 13:100588909-100588931 GGGTGGGTCTGGCTGTTAGGCGG - Intronic
1112701316 13:102012200-102012222 AGGAGGGGCTGGGGGTGAAGGGG + Intronic
1113329970 13:109318011-109318033 GGGTGGGCCGGGGGGTGAGGGGG - Intergenic
1113538970 13:111092107-111092129 AGGTGGGGCAGAGTGTCAGGTGG + Intergenic
1113559781 13:111269543-111269565 AGGTGGGTTTTTGAGTCAGGAGG + Intronic
1113565971 13:111320103-111320125 AGGTGTGTCTGGGGCTGACGAGG - Intronic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1113800562 13:113084317-113084339 AGGAGGTTCTGGGGTACAGGAGG - Intronic
1113800567 13:113084334-113084356 AGAAGGTTCTGGGGTTCAGGAGG - Intronic
1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG + Intergenic
1114119833 14:19658935-19658957 AGGTGTGTCTGGGAGTGTGGGGG - Intergenic
1114276363 14:21149073-21149095 AGTTTGGACTGTGGGTCAGGAGG + Intergenic
1115546163 14:34466534-34466556 GGGTGGGACTGGGGGTGGGGCGG - Intergenic
1117722014 14:58637815-58637837 AGGCGGCTCTGGGGGCCGGGCGG + Intronic
1118486870 14:66222724-66222746 AGATGGGGTTGGGGGTGAGGTGG - Intergenic
1118877367 14:69796779-69796801 AGGTAGGCCTGGGGGTGAGGAGG - Exonic
1119305934 14:73608147-73608169 AGGTGGGTCACAAGGTCAGGAGG - Intergenic
1119395150 14:74320810-74320832 AGGTGGATCATGAGGTCAGGAGG - Intronic
1119728595 14:76937250-76937272 AGGGAGGACTGGGGGTCAGGTGG - Intergenic
1120153057 14:81059060-81059082 ACATGTGTCTGGGGGTCATGAGG + Intronic
1120495582 14:85230560-85230582 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1121009086 14:90509453-90509475 AGGAGTGTCTGGGGTCCAGGAGG - Intergenic
1121255066 14:92525127-92525149 AGGTGTGTATGGGGGTGGGGTGG + Intronic
1121432150 14:93895176-93895198 AGGTGGGCCTGGGTGGCAGCAGG - Intergenic
1122202043 14:100128591-100128613 AGGTGGGACTGGGGGTGGGGGGG - Exonic
1122374531 14:101249142-101249164 ACGTGGGTTTGGAGGTGAGGAGG + Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122411462 14:101528156-101528178 AGGTGGGTGTGGTGGTTTGGCGG + Intergenic
1122504069 14:102220495-102220517 AGGTGGATCACGAGGTCAGGAGG + Intronic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122611297 14:102985135-102985157 AGGGTGGTGTGGAGGTCAGGAGG + Intronic
1122611357 14:102985390-102985412 AGGGTGGTGTGGAGGTCAGGAGG + Intronic
1122629675 14:103101838-103101860 AGGTGGGTGTGGGATCCAGGCGG + Intronic
1122652347 14:103232573-103232595 GGGTGGGGCTGGGAGGCAGGAGG + Intergenic
1122866038 14:104604374-104604396 AGGTGGGTCTGGGGGCGCTGGGG + Intronic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1123670978 15:22656976-22656998 AGGTGGATCACAGGGTCAGGAGG + Intergenic
1123696062 15:22880061-22880083 AGGTGGGGTTGGGGGACTGGAGG + Intronic
1124142498 15:27089173-27089195 AGCAGGGCCTTGGGGTCAGGAGG + Intronic
1124323026 15:28730183-28730205 AGGTGGATCACAGGGTCAGGAGG + Intronic
1124829078 15:33130056-33130078 AGGTGGATCACGAGGTCAGGTGG - Intronic
1125474920 15:40040519-40040541 AGGTGCGGGTGGGGGTGAGGAGG + Intergenic
1125597849 15:40899065-40899087 AGGGTGGTGTGGGGGCCAGGAGG + Intronic
1126102833 15:45129963-45129985 GGGCGGGGCTGGGGGTGAGGAGG - Exonic
1126850944 15:52796394-52796416 AGGTGGGGCTGCGGGGCAGATGG + Intergenic
1127008332 15:54595146-54595168 AGGTGGGAGTGGGTTTCAGGAGG + Intronic
1128092804 15:64930546-64930568 AGATGGATCTGGGGGACATGAGG + Intronic
1129060106 15:72853937-72853959 ACGTGGATCTGGAGCTCAGGGGG - Intergenic
1129453723 15:75664831-75664853 AGGTGGGCCTGAGGTTCAGGGGG - Intergenic
1129465375 15:75721732-75721754 AGGTGGGGGTGGGTGGCAGGTGG + Intergenic
1129738904 15:77980334-77980356 AGCTGGGTCTCTGGGACAGGAGG - Intergenic
1129740220 15:77986400-77986422 GGCTGGGTCTCGGGGGCAGGTGG - Intronic
1129769821 15:78195831-78195853 AGGTGGGTCTGGCCAGCAGGTGG - Intronic
1129845531 15:78766199-78766221 AGCTGGGTCTCGGGGGCAGGTGG + Exonic
1130131910 15:81150689-81150711 AGGTGGGTTTGGGCTTCAGCTGG + Intergenic
1130254713 15:82320595-82320617 AGCTGGGAGTGGGGGTCGGGAGG - Intergenic
1130256320 15:82327660-82327682 GGCTGGGTCTCGGGGGCAGGTGG - Intergenic
1130257050 15:82330624-82330646 AGCTGGGTCCGGGAGTCAGCTGG + Intergenic
1130597900 15:85259366-85259388 AGCTGGGTCCGGGAGTCAGCTGG - Intergenic
1130598632 15:85262328-85262350 GGCTGGGTCTCGGGGGCAGGTGG + Intergenic
1130600260 15:85269411-85269433 AGCTGGGAGTGGGGGTCGGGAGG + Intergenic
1131138968 15:89961789-89961811 AGGTGGATCATGAGGTCAGGAGG + Intergenic
1131175013 15:90203968-90203990 AGGTGGGTATGAGGGCCAGGAGG - Intronic
1131451470 15:92543920-92543942 AGGTGGGGATGGGGGTGAGTGGG - Intergenic
1132079862 15:98854690-98854712 AGGCGGGTCTGGGAGCCAAGAGG + Intronic
1132110368 15:99098392-99098414 AGCTGGGTCTAGGGAGCAGGAGG - Intronic
1132350315 15:101135692-101135714 AAGTGAGTCTAGGGGTCAGGAGG - Intergenic
1132572775 16:651265-651287 AGGTGGGTCTGGGGGGTCAGCGG + Exonic
1132588880 16:717800-717822 AGGTGCTTCTGGGGCTCAGCAGG + Exonic
1132665303 16:1078753-1078775 AGGCGGGGCTGGGGCCCAGGAGG + Intergenic
1132666648 16:1083925-1083947 AGGTGGGGTTGGGAGTAAGGAGG - Intergenic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1132992960 16:2806553-2806575 AGCTGGTTCTGAGGGACAGGAGG + Intergenic
1133234287 16:4380586-4380608 AGGAGGGCCTGGGGTTCAGGAGG + Intronic
1133283840 16:4681487-4681509 AGGAGCGTCTGGGGAGCAGGTGG + Intronic
1133428859 16:5718359-5718381 ATATGTGTCTGTGGGTCAGGTGG - Intergenic
1134089684 16:11384867-11384889 CGGTGGGTCTGGGCCCCAGGAGG - Exonic
1134117623 16:11561083-11561105 AGGTGGGTCTGGGGCTGTGACGG - Intronic
1134453899 16:14379921-14379943 AGATGGGCCTGGGGGTTGGGTGG - Intergenic
1134671976 16:16062605-16062627 AGATGGGCCTGGGTGTCAGCTGG + Intronic
1134903897 16:17962908-17962930 AGGGGGGGGTGGTGGTCAGGAGG - Intergenic
1135225224 16:20650085-20650107 AGGGAAGTCTGGGGTTCAGGAGG - Intronic
1135571347 16:23551691-23551713 AGGTGGATCACGAGGTCAGGAGG + Intronic
1136248540 16:28989108-28989130 AGGTGGGGATGGGGGTCGGGGGG + Intronic
1136402942 16:30028374-30028396 AGGGGGGCCTGGGGAGCAGGGGG + Intronic
1136409725 16:30069252-30069274 AGGTGGGACTCTGGGTTAGGAGG + Intronic
1136542620 16:30936670-30936692 AGGTGGATCATGAGGTCAGGAGG - Intronic
1136598172 16:31265938-31265960 TGGTGGGGCTGGGGGTCTTGTGG + Intronic
1137579072 16:49622399-49622421 AGGTGAGTCTGGGGGGCTGTAGG - Intronic
1137872908 16:51967773-51967795 GGGAGGGGCTGGGGGGCAGGAGG - Intergenic
1138247332 16:55477699-55477721 AGATAGGACTGGGGGTCAGCAGG - Intronic
1138414779 16:56865364-56865386 AGGTGCTGCTGTGGGTCAGGTGG - Exonic
1139999809 16:71013773-71013795 AGGAGAGTCTGGGGGTGAGCAGG + Intronic
1141150179 16:81559058-81559080 TGGTGGCTCTGGGCGGCAGGAGG - Intronic
1141452920 16:84117401-84117423 CCGTGGGGCCGGGGGTCAGGAGG - Intergenic
1141767111 16:86065943-86065965 TGCTGGGTGTTGGGGTCAGGAGG - Intergenic
1142005563 16:87688034-87688056 TGGTGGGGCTGGGCGTCAGGTGG + Intronic
1142055967 16:87996246-87996268 AGGTGGGTCCCGGTCTCAGGCGG - Intronic
1142117923 16:88369809-88369831 AGCTGGGGCTGGGGGTCGCGGGG - Intergenic
1142122121 16:88391631-88391653 AGGTGGGGCCGGGGGACAGGAGG + Intergenic
1142621302 17:1167221-1167243 AGGTGGAGCTGGGTGTTAGGAGG - Intronic
1142661453 17:1432549-1432571 AGGTGGATCACGAGGTCAGGAGG + Intronic
1142666700 17:1467652-1467674 GGGTGGATTTGGGGGTCAGGAGG - Intronic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143079250 17:4369159-4369181 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1143282484 17:5765251-5765273 GAGTGGGGCTGGGAGTCAGGTGG - Intergenic
1143448994 17:7024490-7024512 AGGTGGGTCTGGGTGTCCTTCGG - Exonic
1143555318 17:7656233-7656255 AGGTGGGTGGGTGGGTCAGTGGG - Exonic
1143575777 17:7792349-7792371 AGCTGGGCCTGGGTGTGAGGAGG + Intronic
1143970531 17:10792096-10792118 AGGTGGGCCTGGGGAACAGTAGG + Intergenic
1144170706 17:12657283-12657305 AGCTGGGTCTGAGGCTGAGGTGG + Intergenic
1144733363 17:17541308-17541330 AGCTGGGGCTCGGGATCAGGTGG - Intronic
1144769103 17:17749328-17749350 AGCTGTCTCTGGGGCTCAGGAGG - Intronic
1145059260 17:19722037-19722059 AGGTGGGGGTGGAGGTCACGAGG + Intergenic
1145976354 17:28986385-28986407 TGGTGGGGCTGGGGCGCAGGTGG - Intronic
1146676587 17:34777554-34777576 AGGATGGTCTGGGGATAAGGAGG + Intergenic
1146794311 17:35770317-35770339 AGGTGGGGCAGAAGGTCAGGGGG + Intronic
1147438331 17:40431535-40431557 AGGAGGGTCTGGGGGTCCCCTGG + Intergenic
1147548665 17:41422639-41422661 AGGTGGGTCTGAGGGTCCAGAGG - Intronic
1147550623 17:41439065-41439087 AGGTGGGTCTGAGGGTCCAGAGG - Intronic
1147612662 17:41811111-41811133 AGGTGGGGTGGAGGGTCAGGAGG - Exonic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1147667922 17:42160310-42160332 AGGAGGGTCTGGGGTCCAAGCGG + Exonic
1147728589 17:42582314-42582336 ATGTGGGGCTGGGGCACAGGAGG - Intronic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1147905373 17:43819018-43819040 AGATGGGTCTGGGGTTCCCGAGG + Intronic
1147940144 17:44040746-44040768 AGGTGGATCACGAGGTCAGGAGG + Intronic
1148156150 17:45426144-45426166 GGGTGGGGCTTGGGGTCAGGGGG + Intronic
1148700635 17:49584575-49584597 TGGGGGGTCGGGGGGCCAGGGGG + Intergenic
1148712059 17:49689142-49689164 AGGTAAGTCTGGGGCTCAAGAGG - Intergenic
1148743026 17:49903515-49903537 AGGAGGGTCTGGGAGACAGATGG - Intergenic
1149422930 17:56528304-56528326 AGCTGGGACTGGGGGTGGGGAGG + Intergenic
1149498942 17:57136644-57136666 AGATGGGGCTGGGGGTGAGGTGG + Intergenic
1149654358 17:58302489-58302511 AAATGGGTCAGGGGGTCAGGAGG - Intronic
1149656417 17:58311715-58311737 AGGTGGGCCTGGGGGCAGGGGGG + Exonic
1150103599 17:62445133-62445155 GGGTCTGTCTGGGGGTGAGGGGG + Intronic
1150141595 17:62734336-62734358 GGGTGGGTGAGGGGCTCAGGAGG + Intronic
1150225039 17:63519888-63519910 TGGTGAGGCTGGGGGGCAGGAGG + Intronic
1150248174 17:63691374-63691396 TGGTGGGACTTGGAGTCAGGAGG + Intronic
1150472763 17:65451145-65451167 AGGAGGGTCTGGGTGTCAAAAGG + Intergenic
1150524283 17:65905701-65905723 AGGTGGATCACGAGGTCAGGAGG + Intronic
1151232708 17:72696156-72696178 AGGTGGGATTGGGAGTCATGGGG + Intronic
1151271018 17:72996070-72996092 AGGTGGCTCTGGGGTGAAGGAGG - Intronic
1151306793 17:73267741-73267763 GGGAGGGGCTGGAGGTCAGGAGG + Intergenic
1151311047 17:73292593-73292615 GAGTGGGTGTGGGAGTCAGGGGG + Intronic
1151456524 17:74229462-74229484 AGGTGGGGCTGGGGGTGGGGAGG - Intronic
1151554347 17:74839094-74839116 ATGAGGCTCTGGGGCTCAGGTGG - Exonic
1151684691 17:75639663-75639685 TGGGGGGCCTGGGGGACAGGGGG + Exonic
1151785986 17:76275353-76275375 AGTTGGGCCTGAAGGTCAGGAGG - Intronic
1152182316 17:78830998-78831020 AGGTGGATCGCGAGGTCAGGAGG + Intronic
1152250179 17:79208390-79208412 GGGTGGGGCTGGGAGTCAGTCGG + Intronic
1152288263 17:79424668-79424690 AGGCAGGTCTGTGGCTCAGGAGG + Intronic
1152528400 17:80902719-80902741 ATGGGTGTCTGGGGGTGAGGAGG - Intronic
1152636547 17:81432740-81432762 GGGTGGGTCTGGGGCTCGGGGGG - Intronic
1152650622 17:81490881-81490903 AGAGGGGGCTGGGGGCCAGGTGG + Intergenic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152863310 17:82708842-82708864 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863344 17:82708922-82708944 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863377 17:82709002-82709024 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1153041693 18:818939-818961 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1154037366 18:10816171-10816193 AGGTGGGTCTGGGGATGGAGAGG - Intronic
1154112889 18:11585551-11585573 AGTTGGGTCTGGGGCTCTTGAGG + Intergenic
1154189885 18:12221179-12221201 AGGGGTGTGTGGGGGGCAGGAGG + Intergenic
1155208180 18:23578526-23578548 AGGCAGGCCTGGGGGCCAGGAGG - Intronic
1155229464 18:23758510-23758532 AGGTGGGTGTGGGGATGGGGTGG + Exonic
1155736287 18:29226608-29226630 AGGTGGGTTTGGTGGTGGGGGGG - Intergenic
1156192709 18:34738152-34738174 ACATGGGCCTGGGGGCCAGGTGG + Intronic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1157674921 18:49561775-49561797 AGGAGGATCTGGGTGTCCGGAGG + Intronic
1158507318 18:58058079-58058101 AGGTGGATCACGAGGTCAGGAGG + Intronic
1158865820 18:61636804-61636826 AGCTTGGTCTGGAGGTGAGGAGG - Intergenic
1158997696 18:62940000-62940022 GGGTTGATCTGGGGGCCAGGGGG + Intronic
1159836517 18:73343219-73343241 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1160499298 18:79394439-79394461 GCGGGGGTCGGGGGGTCAGGGGG - Intergenic
1160600890 18:80011727-80011749 AGGTGGGAGTGGGTTTCAGGAGG - Intronic
1160680555 19:410074-410096 AGGGGGGTCGGGGCCTCAGGAGG - Intergenic
1160744490 19:704218-704240 AGGCGGGTCCGAGGTTCAGGGGG + Intergenic
1160827915 19:1089302-1089324 GGTGGGGTCTGGGGGTCTGGGGG + Intronic
1160917877 19:1506389-1506411 AAGAGGGACTGAGGGTCAGGTGG + Intronic
1161398782 19:4058663-4058685 AGGAGGGTCTGGTGGCCCGGAGG - Intronic
1161620007 19:5292869-5292891 AGGTCGGGCTGGGGGCCAGGCGG + Intronic
1162364168 19:10237989-10238011 AGGTAGGAATGGGGGTCAGAGGG - Intergenic
1162402099 19:10452866-10452888 AGGTGGTGCTGGGGGTGGGGGGG - Intronic
1162638402 19:11987982-11988004 GGGTGGGTCTGGGCGGCAGTCGG + Intergenic
1162794452 19:13079271-13079293 GGCTGGGTCTAGGGGACAGGTGG + Intronic
1163018618 19:14471433-14471455 TGGGGGGACTGGGGCTCAGGAGG - Intronic
1163421210 19:17214647-17214669 ATGGGGGTCTGGGCGTTAGGGGG + Intergenic
1163422608 19:17222651-17222673 GGGTGGATCTAGAGGTCAGGAGG + Intergenic
1163526475 19:17824586-17824608 AGCTGGGGCTGGGAGTGAGGGGG + Intergenic
1163628034 19:18402104-18402126 AGGTGGGTCTGGGGGAGCCGGGG + Intergenic
1163702215 19:18791517-18791539 TGGTGGGGCAGGGAGTCAGGGGG + Intergenic
1163825867 19:19524579-19524601 AGGTGGATCATGAGGTCAGGAGG + Intronic
1163830959 19:19546971-19546993 AGGTGTGGCCGGGGTTCAGGTGG - Intergenic
1164525990 19:29014216-29014238 CGGTGGGCCTGGGTGTCACGCGG - Intergenic
1164726528 19:30469186-30469208 AGGTGGATCACGAGGTCAGGAGG + Intronic
1164802415 19:31088586-31088608 AGGTGGGGCTGGGGATGAAGTGG + Intergenic
1164927239 19:32140094-32140116 AGGTGGGAATGGGGGTCGGCGGG - Intergenic
1165250033 19:34523676-34523698 ATGTGGGTCTGGTGCACAGGTGG + Intergenic
1165712669 19:38023249-38023271 CGGTGGGGCCGGGGGTCAGGGGG + Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1165924342 19:39318090-39318112 AGGTGGCTCTGGGGAGCAGGTGG - Intergenic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1166352091 19:42204077-42204099 AGGTGGGGGTGGGGGACAAGAGG - Intronic
1166363985 19:42269413-42269435 AGGGGGGTCCGGGGGGCTGGGGG + Intronic
1166381540 19:42357583-42357605 AGGTGGGGCTGGGGACCGGGAGG + Exonic
1166648762 19:44553903-44553925 TGCAGGGTCTGGGGGTCAGGGGG + Intergenic
1166699431 19:44873901-44873923 AGGAGGGTCTGGGGGAAATGGGG - Exonic
1166774911 19:45306639-45306661 AGGTGGGACTCTGGGACAGGGGG + Exonic
1166781759 19:45346822-45346844 AGGAGGGTCTGGGGGACTGTGGG - Intronic
1166781775 19:45346880-45346902 AGGAGGGTCTGGGGGACTGTGGG - Intronic
1167197811 19:48042797-48042819 AGGTGGATCACGAGGTCAGGAGG - Intronic
1167263593 19:48472478-48472500 AGCTGGGTCTGGGGGGTGGGAGG - Intronic
1167465890 19:49651030-49651052 AGGTGGGGCTGGGGGTGCAGGGG - Exonic
1167520649 19:49952424-49952446 AGGAGGGTCTCAGGGCCAGGAGG - Intronic
1167537755 19:50065822-50065844 GGGTAAGTCTGGGGGCCAGGAGG + Intergenic
1167550145 19:50154770-50154792 GGGTGGGTATGGGGCTAAGGAGG - Intronic
1167576435 19:50320177-50320199 TGGGGAGTCTGGGGGTCCGGGGG + Intronic
1167667965 19:50833618-50833640 AGCTGGGTCTGGGGGTGTGGTGG + Intronic
1168057130 19:53869951-53869973 AGGAGGGGCTGGGGGCCTGGGGG + Intronic
1168255152 19:55161013-55161035 AGGTGGGGCTGGGGGTCGGTGGG - Intronic
1168263240 19:55208115-55208137 AGGAGGGCCTGGGGGCCTGGGGG + Intronic
1202660428 1_KI270708v1_random:64568-64590 AGGTGGGTCACAAGGTCAGGAGG + Intergenic
925067771 2:941973-941995 TGGTGGTTCTGGTGGGCAGGGGG - Intergenic
925235150 2:2271560-2271582 TGGTGGTTCTGGGAGTCAGCTGG + Intronic
925302255 2:2825766-2825788 AGGTGGGTCTGCTGGTGAGTTGG - Intergenic
925505347 2:4556275-4556297 AGGTGTGTGTGGGGGTGGGGTGG + Intergenic
925577917 2:5379894-5379916 AAATGTGTCTGGGGGTAAGGAGG + Intergenic
925686676 2:6480511-6480533 ACGTGGGTCTGGGATCCAGGAGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926703512 2:15819917-15819939 AGGTGGAGGTGGAGGTCAGGCGG + Intergenic
927111828 2:19869208-19869230 TGGGTGGGCTGGGGGTCAGGAGG - Intergenic
927736187 2:25524617-25524639 AGGTGGGGCTGTGAGGCAGGTGG + Intronic
928147617 2:28793747-28793769 AGGGTGGTTTGGGGGTGAGGTGG + Intronic
928362079 2:30671922-30671944 AGGTGGATCACGAGGTCAGGAGG + Intergenic
928649345 2:33388221-33388243 AGGGGAGTCTAGGAGTCAGGGGG + Intronic
929025049 2:37592539-37592561 AGGTGGATCAGGAGGTCAGGAGG + Intergenic
929568236 2:43003717-43003739 AGGTGGATCATGAGGTCAGGAGG - Intergenic
930423714 2:51186649-51186671 AGGTGGATCACGAGGTCAGGAGG - Intergenic
930704912 2:54495184-54495206 AGGTTGGTCTGGAGGACAGCAGG + Intronic
930711200 2:54552679-54552701 AGGTGGATCACGAGGTCAGGAGG - Intronic
931357614 2:61550824-61550846 AGGTGAGGGTGGGGGTTAGGGGG + Intergenic
931730827 2:65151897-65151919 AGGTGGGTGGCGGGGGCAGGGGG + Intergenic
932486143 2:72085433-72085455 AGGTGGGTCTGGGGAACAGTGGG - Intergenic
932577634 2:72971549-72971571 ACGTGGGTCTGGGGGTTCGCAGG - Exonic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
932763551 2:74456146-74456168 AGGAGGGTTAGGGGGTCAGGAGG + Exonic
933840741 2:86284009-86284031 AAGTAGGCCTGGGGGTGAGGGGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934781994 2:96976317-96976339 AGGTGGATCATGAGGTCAGGAGG - Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
936006595 2:108894407-108894429 TGGTGGGTCGGGGGGTGAGTGGG - Intergenic
936618970 2:114075377-114075399 AGGTGGGGGTGGGGGTGGGGTGG + Intergenic
937265268 2:120611384-120611406 ATGTGGACCTGGGGGTCGGGAGG - Intergenic
937303566 2:120857593-120857615 AGGTGGGTGTTTGGGTGAGGTGG - Intronic
937810503 2:126194625-126194647 AGGTGGATCATGAGGTCAGGAGG + Intergenic
937811171 2:126200980-126201002 AGATGGGGCTGGGGGACAAGAGG + Intergenic
937914438 2:127092097-127092119 AGGTGGGTGTAGGGGTGTGGTGG - Intronic
937985445 2:127636193-127636215 AGGATGCTCTGGGGGACAGGAGG - Exonic
938284222 2:130095238-130095260 AGGTGGATCATGAGGTCAGGAGG - Intronic
938431385 2:131243653-131243675 AGGTGGATCATGAGGTCAGGAGG + Intronic
938658310 2:133458730-133458752 AGGAGGATCTGGGTGGCAGGAGG + Intronic
939128731 2:138207766-138207788 GGGTGGGTCTAGTGGTCATGGGG + Intergenic
940842849 2:158604566-158604588 AGGCTGGTGTGGTGGTCAGGTGG + Intronic
941659292 2:168178980-168179002 AGCTGGGAGTCGGGGTCAGGAGG + Intronic
942187908 2:173441902-173441924 ACGTGGGTATGGGACTCAGGTGG - Intergenic
942379313 2:175371694-175371716 TGGTGGGGCTGGGGGTAGGGTGG + Intergenic
943757130 2:191568496-191568518 AGGTGGCCCTGGGGGTAGGGAGG + Intergenic
944238246 2:197460415-197460437 AGGTGGATCATGAGGTCAGGAGG - Intronic
946363480 2:219233870-219233892 AGGTGGGTCTGCGGGTGGCGAGG - Exonic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
947523440 2:230865148-230865170 GAGAGGGTCTGGGGCTCAGGCGG + Intronic
948048525 2:234961880-234961902 GGGTGGGGGTGGGGGTGAGGAGG + Intronic
948300978 2:236907177-236907199 AGGTGGGGTTGGGGGACAAGGGG + Intergenic
948582287 2:238996557-238996579 AGGAGGGTCTTGGGGGCAGCCGG + Intergenic
948609745 2:239159361-239159383 AGGGGGGTGTGGGTGTGAGGTGG - Intronic
948678189 2:239611422-239611444 AGGTGTGTCTGGGAGCCAGTGGG + Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948803526 2:240443357-240443379 AGGGAGGCCTGGGGGCCAGGAGG + Intronic
948814483 2:240502876-240502898 AGGTGGGGCAGGGGGCCTGGGGG - Intronic
948925621 2:241095063-241095085 AGGTGGGTGTGGGGGGGGGGGGG - Exonic
1168747134 20:253288-253310 AGGGAGGTCTGGGGCTCAGGAGG + Intergenic
1168846407 20:947497-947519 AGAGGGGTCTGGGTGTCTGGAGG - Intergenic
1170037365 20:12003603-12003625 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1170696660 20:18665216-18665238 AGTTGGGGCTGGGGGCCAGGGGG + Intronic
1171078662 20:22155465-22155487 AGGTGGATTGGGGGGTCAGATGG + Intergenic
1172072152 20:32265904-32265926 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1172093739 20:32450753-32450775 ATGGGGGTCTGGGGCTCAGCAGG - Intronic
1172618877 20:36306913-36306935 AGGGCGGCCTGGGGGTCAGGCGG + Intronic
1172694924 20:36815965-36815987 AGGTGGCTGTGGGGGTCCTGAGG - Exonic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1172763244 20:37336612-37336634 TGGTGGGGCTGGGGGACGGGGGG - Intergenic
1172799247 20:37564678-37564700 TGGGGGCTCTGGGCGTCAGGCGG - Intergenic
1173127833 20:40356351-40356373 ATGTGGGACTTGGGGACAGGAGG + Intergenic
1173128678 20:40365729-40365751 AAGTTGGTCTTGGGGTCAGCTGG + Intergenic
1173183357 20:40820979-40821001 GGGTGGGTGTGGGAGACAGGGGG - Intergenic
1173652938 20:44678782-44678804 GGGTTGGCCTGGGGGGCAGGCGG + Intergenic
1173654309 20:44689371-44689393 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173713868 20:45184304-45184326 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1173734141 20:45347907-45347929 AGATGGCCCTGGGGGTCGGGGGG - Intronic
1173895150 20:46545530-46545552 AGGTGGGTGGAGGGGCCAGGAGG + Exonic
1173956962 20:47040823-47040845 GGGAGTGTCTGGGGGTTAGGGGG + Intronic
1174299072 20:49568686-49568708 AGGAGTGTAAGGGGGTCAGGAGG + Intergenic
1174411757 20:50341053-50341075 ATGTGGGACTGTGGGACAGGAGG - Intergenic
1175110050 20:56641566-56641588 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175277801 20:57783672-57783694 AGGGGGGTAGGGGGGTAAGGAGG - Intergenic
1175341349 20:58232160-58232182 GGGTGGGGCAGGGGGTGAGGTGG + Intergenic
1175385382 20:58591663-58591685 AGCAGGGTCTGGGGGTCTGGAGG - Intergenic
1175444528 20:59010836-59010858 AGGTGGGGGTGGGGGTTGGGAGG + Intergenic
1175531518 20:59676447-59676469 AGGTGGGGGTGGGGGTGAGGAGG - Intronic
1175722242 20:61294307-61294329 AGGTGGGTCTGGGGCAACGGGGG + Intronic
1175825590 20:61934803-61934825 AGGTTGGGCAGGTGGTCAGGCGG - Intronic
1176020083 20:62958414-62958436 AGGTGGGTGGGGGGGCCAAGGGG + Intronic
1176092106 20:63322774-63322796 AGGTGGGTGTCGGGGTCGGGAGG - Intronic
1176115234 20:63429270-63429292 AGGTGGGTCAGGGAGCCGGGTGG - Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176168265 20:63685698-63685720 AGGTGGGGCTGGGGGTCTTCTGG + Intronic
1176299135 21:5090358-5090380 AGGTGGGCTTGGGGGTCACAGGG + Intergenic
1176812825 21:13561891-13561913 AGCTGGTTCTTGGGGTAAGGGGG + Intergenic
1178485581 21:33018257-33018279 AGTTGCCTCTGGGGGTCTGGGGG + Intergenic
1178618195 21:34152488-34152510 ACCAGGCTCTGGGGGTCAGGAGG - Intergenic
1179600538 21:42474713-42474735 AGGTGGGACGTGGGGTCAGGTGG - Intronic
1179857891 21:44171590-44171612 AGGTGGGCTTGGGGGTCACAGGG - Intergenic
1180462912 22:15583150-15583172 AGGTGTGTCTGGGAGTGTGGGGG + Intergenic
1181361104 22:22336751-22336773 CGGGGGGGCTGGGGGTCAAGGGG + Intergenic
1181631056 22:24151584-24151606 AGGTGGGGGTGGGGCTCAGAGGG + Intronic
1181634931 22:24170093-24170115 AGGTAGGTCTGAGGGTCATTAGG - Intronic
1181690151 22:24554828-24554850 AGGCGGGTGTGGGGGCGAGGCGG + Intronic
1181695920 22:24592802-24592824 GGGAGGGTCTGGGGGTCTGGGGG - Intronic
1182048942 22:27298730-27298752 AGGTGGGTATGGGAGTGAGGAGG + Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1183337113 22:37256234-37256256 AGCTGGGTTTGGGGATCGGGTGG - Intergenic
1183352866 22:37343692-37343714 GGGTGGGTCTGGGAGCCAAGGGG - Intergenic
1183484079 22:38080134-38080156 AGGTGGGAGTGGGGGACATGAGG - Intronic
1183494507 22:38134951-38134973 AGGTGGGTGGGTGGGGCAGGGGG - Intronic
1183521752 22:38299732-38299754 AGGTGGATCATGAGGTCAGGAGG - Intronic
1183708654 22:39489855-39489877 AGCTGGGACTGGGTGTCAGAAGG - Exonic
1183910412 22:41074895-41074917 AGTTGGCTTTGGGGTTCAGGGGG + Intergenic
1184160898 22:42696799-42696821 AGGTGTGGCTGGGGCACAGGTGG - Intronic
1184296598 22:43529064-43529086 AAGTGGGGTTGGGGATCAGGTGG - Intronic
1184308824 22:43628084-43628106 ATGTGAGGCTGTGGGTCAGGGGG - Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184398336 22:44258889-44258911 TGGAGGGTTGGGGGGTCAGGGGG + Intronic
1184406535 22:44303859-44303881 AGGTGGGGCTGGGGGATGGGAGG - Intronic
1184490195 22:44803962-44803984 AGGTGGGTCTGGTGGCCTGGGGG - Intronic
1184582943 22:45429488-45429510 TGGTGGGTCTGGGGAGGAGGAGG + Intronic
1184689232 22:46109971-46109993 AGGTGGGGCTGGGGGCCCAGGGG + Intronic
1184695011 22:46134164-46134186 AGTTGGGGTTGGGGGTCAGGAGG - Intergenic
1184763911 22:46561852-46561874 AGGGAGGTCTGGGGGTCTTGAGG + Intergenic
1184770667 22:46594813-46594835 AGCTGGGGTTGGGGGTGAGGAGG + Intronic
1184783042 22:46658617-46658639 AGGTGGCTCTGGGGCTCTGCAGG - Intronic
1184879341 22:47295165-47295187 AAGTGGATCTGGGGCTGAGGAGG - Intergenic
1184975701 22:48060181-48060203 AAGAAGGTCTGGGGGTCATGTGG + Intergenic
1185217666 22:49611353-49611375 AGCTGGGTCTGGGGGCTGGGTGG - Intronic
1185281330 22:49971313-49971335 AGGCGGATCTGGGGGCCGGGGGG + Intergenic
1185296629 22:50058053-50058075 AGGCGGGTCTGGGGTTCCGAAGG + Intergenic
1185353676 22:50352501-50352523 AGGTGGATCACGAGGTCAGGAGG + Intronic
1185388649 22:50547748-50547770 AGCTGGGGCTGGGGCTGAGGTGG - Intergenic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
950167305 3:10811190-10811212 AGGAGGGTCTGGGGTTCTGGAGG - Intergenic
950477554 3:13223529-13223551 AGCTGGGAATGGGGGACAGGTGG + Intergenic
950502452 3:13373013-13373035 AGGTGGCTCTGGGTCTCAAGCGG + Intronic
950738832 3:15033419-15033441 GTGTGGTTCTGTGGGTCAGGTGG + Intronic
950870638 3:16225468-16225490 AGGTGGATCACGAGGTCAGGAGG + Intronic
951300856 3:20994737-20994759 AGGGAGGTCCGGGGCTCAGGAGG + Intergenic
952334545 3:32392677-32392699 AGGGGGCTCTGGAGGGCAGGGGG + Intronic
952619052 3:35313921-35313943 AGGTGGATCACGAGGTCAGGAGG + Intergenic
953213536 3:40897340-40897362 AGGTGGTTCAGGGAGTCATGTGG - Intergenic
953226237 3:41024206-41024228 AGGTGGGTCTGGGGCTTTGCAGG + Intergenic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
953546167 3:43864930-43864952 AGGAGGGACTTGGAGTCAGGTGG - Intergenic
954104612 3:48403276-48403298 AGTTGGGTCTGTAGGGCAGGGGG - Intergenic
954144844 3:48629424-48629446 AGATGGGTCTGGGGCTGGGGAGG - Intronic
954256019 3:49406908-49406930 GGGTGGGTCACGGGGTCACGAGG + Intronic
954370840 3:50168902-50168924 AGATGGGACTGGGGGACAAGGGG - Intronic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
954705782 3:52479861-52479883 AGGTGGGTTTGTGTGGCAGGTGG + Exonic
955059828 3:55485142-55485164 AGTGGGGTCTGGTGGTCGGGAGG + Intronic
955214606 3:56974667-56974689 AGATGGATGTGGGGGGCAGGGGG - Intronic
956903751 3:73744130-73744152 TGGTGGGTCTGAGGGTCAGCTGG + Intergenic
957194298 3:77047815-77047837 AGGTGGATCACGAGGTCAGGAGG + Intronic
957675357 3:83357252-83357274 GGTTGGGTCTGAGGGGCAGGTGG + Intergenic
959822703 3:110755515-110755537 AGGTGGGGCCTGAGGTCAGGAGG + Intergenic
960105185 3:113788130-113788152 AGGCTGGTCTTGGGCTCAGGCGG + Intronic
960954936 3:123025658-123025680 AGGTGAGTGTGGGTTTCAGGGGG - Intronic
960966978 3:123112286-123112308 AGGTGTGTGTGTGGCTCAGGAGG + Intronic
961012889 3:123448054-123448076 AGGTGGGTCTGGAGGAGCGGCGG - Exonic
961144847 3:124585015-124585037 GGATGGGGCTGGGGATCAGGAGG + Intronic
961454954 3:127019404-127019426 AGGTGTGTGTTGGGGCCAGGTGG + Intronic
961501591 3:127340209-127340231 GGCTGGGTCTGGGAGTCATGGGG - Intergenic
961787023 3:129353456-129353478 AGCTGGGGATGGGGGACAGGTGG - Intergenic
961891959 3:130137815-130137837 AGGTAGGTGTGGGGGTCACAAGG + Intergenic
962204504 3:133423844-133423866 AGGTGGCTTTGGCAGTCAGGAGG - Intronic
962254532 3:133861368-133861390 ATGTGTGTTTGGGGGTGAGGAGG + Intronic
962752460 3:138443902-138443924 AGATGGGTCTGGGGTTGGGGTGG - Intronic
962958723 3:140290476-140290498 AGGTGGGATTGAGGGACAGGAGG + Intronic
963001799 3:140688331-140688353 AGGTGGGTCTGGAGGCCTGTGGG + Exonic
963042783 3:141081610-141081632 AGGAGGGCCTGGGGGACAGCAGG + Intronic
963285258 3:143428913-143428935 GGGTGGGGATGGGGATCAGGAGG + Intronic
965540935 3:169870733-169870755 AGGTGGGGATGTGGGTCAGGGGG + Intergenic
965540937 3:169870741-169870763 ATGTGGGTCAGGGGGTGTGGAGG + Intergenic
966886115 3:184379069-184379091 AGGAAGTTCTGGGGGACAGGGGG - Intronic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967613758 3:191540040-191540062 ATGTGGGCCTGGGGGTCGGGGGG - Intergenic
968556493 4:1248603-1248625 CGGTGGAGCTGGGGGTCCGGCGG + Intronic
968754369 4:2407810-2407832 AGGTGGATCACGAGGTCAGGAGG - Intronic
968831180 4:2933702-2933724 TGATGGGCCTGGGGGGCAGGGGG + Intronic
968895720 4:3401975-3401997 GGGTGGAGCTGGGGCTCAGGGGG - Intronic
968933985 4:3600371-3600393 AGGTGGGCCTGGAGCTAAGGGGG + Intergenic
968937855 4:3622548-3622570 ATGTGGGGCTGGGGGGCTGGTGG - Intergenic
968960485 4:3740762-3740784 AGCTGGGTTTGGGCATCAGGAGG + Intergenic
969264224 4:6054684-6054706 AGCTGGGTCTGGGATGCAGGCGG - Intronic
969494876 4:7520756-7520778 GGCTGAGTCTGGGGGTGAGGTGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
969703320 4:8779491-8779513 AGGTGGGGCTGGACGTCAGCTGG - Intergenic
969853367 4:9979668-9979690 AGGTGGCTCTGGGGTGGAGGCGG - Intronic
970006777 4:11418667-11418689 AGGTGGGGCTTAGGGACAGGAGG + Intronic
970300101 4:14671969-14671991 AGCAGGGGCTGGGGGGCAGGGGG + Intergenic
970710755 4:18859516-18859538 TGGGGAGTCTGGGGGTCTGGAGG - Intergenic
971165333 4:24176750-24176772 AGGTGGGACTGGGGACAAGGAGG + Intergenic
971650082 4:29260029-29260051 AGGTGGGGAAGGGGGTGAGGTGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
973850287 4:54955144-54955166 GGGTGGCTCTAGGGGGCAGGGGG - Intergenic
974184921 4:58432753-58432775 AGGTGGATCATGAGGTCAGGAGG + Intergenic
974430790 4:61793196-61793218 AGGTGGATCATGAGGTCAGGAGG + Intronic
974948794 4:68562337-68562359 AGGTGGATCATGAGGTCAGGAGG - Intronic
976036005 4:80821779-80821801 AGGTGTCTCTGGGTGTCAGCTGG - Intronic
976828413 4:89285196-89285218 GGGTCGGTTGGGGGGTCAGGGGG + Intronic
976861170 4:89668840-89668862 AGGTGGGACTGGGGGTGGGATGG - Intergenic
977235174 4:94499938-94499960 AGGTGGGTCAGGGGGAGGGGAGG - Intronic
977871976 4:102102425-102102447 AGGTGGGTATGGGAGTGATGTGG + Intergenic
978723754 4:111946125-111946147 AGGTGGATCATGAGGTCAGGAGG + Intergenic
979126557 4:116980436-116980458 AGGTGGGAGTGGGTTTCAGGAGG - Intergenic
980195453 4:129582702-129582724 AGGTGGATCATGAGGTCAGGAGG + Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981081242 4:140641609-140641631 AGGTGAGTATGGGGGTGGGGAGG + Intronic
982105937 4:152012143-152012165 AGGTGTGTCTAGGGGTGGGGAGG + Intergenic
982370829 4:154631141-154631163 AGAAGGGTTTGGGGGGCAGGTGG - Intronic
983222885 4:165059511-165059533 TGGTGGCCCTGGTGGTCAGGGGG - Intergenic
983482367 4:168290580-168290602 AGGTGGATCATGAGGTCAGGAGG - Intronic
983661396 4:170133649-170133671 AGGTGGGAGTGGGGTTCAGGAGG + Intergenic
984057674 4:174949415-174949437 AAGTGTCTGTGGGGGTCAGGAGG + Intronic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
985709421 5:1419958-1419980 AGCCAGGTCTGGGGGTCATGAGG - Intronic
986534081 5:8768192-8768214 AAGAGGGTCTGGGTGCCAGGAGG + Intergenic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
987295828 5:16550493-16550515 AGTTATGTCTGGGGGACAGGTGG - Intronic
988556146 5:32237734-32237756 AGGTGGGTCACAAGGTCAGGAGG - Intronic
988565684 5:32318672-32318694 AGGTGGATCATGAGGTCAGGAGG - Intergenic
989117512 5:37969675-37969697 AGGTTAGTCTGGAGGTCAAGAGG + Intergenic
989594360 5:43142528-43142550 AGGTGGATCACGAGGTCAGGAGG - Intronic
989964031 5:50448492-50448514 AGCTGGGTTTCTGGGTCAGGTGG - Intergenic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992364561 5:76078607-76078629 AGGTGGCTGTGGGAGCCAGGGGG - Intergenic
992543263 5:77785210-77785232 AGTTGGCCCTGGGGTTCAGGGGG - Intronic
992792359 5:80224848-80224870 AGGTGGATCACGAGGTCAGGAGG - Intronic
993188986 5:84656922-84656944 GGATGGGTCTGGGGGTGGGGAGG + Intergenic
993478052 5:88389047-88389069 AGCTGGGGCGGGGGGTGAGGCGG + Intergenic
994049060 5:95342284-95342306 AGGTGGCTCTAAAGGTCAGGTGG + Intergenic
994437084 5:99750227-99750249 AGGTGGGTGTGGGGTTGGGGAGG - Intergenic
995340741 5:111056450-111056472 AGGTGGATCACGAGGTCAGGAGG - Intergenic
997327413 5:133033446-133033468 AGGGGGGTTGGGGGGGCAGGTGG + Intergenic
997509755 5:134446105-134446127 AGCTGGGGATGGGGGTAAGGAGG + Intergenic
997590826 5:135071186-135071208 AGCTGGGCCTGGTGGTCAGGTGG - Intronic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
998162480 5:139821456-139821478 AGTTGGGCCTGGGGCTCAGCTGG + Intronic
998333784 5:141352289-141352311 AGTTCCGTCTGGGGGTCAGAGGG - Exonic
1000122009 5:158206583-158206605 ATATGGGTCTGAGGGTCAGCTGG + Intergenic
1001297009 5:170505168-170505190 TGGTGGCTCCGGGAGTCAGGAGG + Intronic
1001797475 5:174514310-174514332 CGCTGGGGCTGGTGGTCAGGGGG - Intergenic
1001849584 5:174951925-174951947 AGGTGGGTTGGGGGGTTGGGGGG + Intergenic
1001949370 5:175805620-175805642 GGGTGGGTCTAGTGGTCAGGGGG + Intronic
1002063775 5:176642164-176642186 AGGTGGGGCAGGAGGTAAGGTGG + Exonic
1002210938 5:177599049-177599071 TGGGGGGGCTGGGGGTGAGGGGG + Intergenic
1002363325 5:178691188-178691210 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1002493543 5:179596779-179596801 AGGGGGGGCGGGGGGGCAGGTGG + Intronic
1002514134 5:179744410-179744432 AGGTGGATCATGAGGTCAGGAGG - Intronic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1003030167 6:2594599-2594621 GGGTGGGTCTGTGGGTCCTGTGG - Intergenic
1003058025 6:2840858-2840880 AGGTGAGTCTGGGGGTGGGGCGG + Intronic
1003606190 6:7563392-7563414 AAGTTGGTCAGGGGCTCAGGTGG - Intronic
1004116612 6:12774624-12774646 AGGTGGATCAGGAGGTCAGGAGG - Intronic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1004505868 6:16246257-16246279 AGCTGGGTGGGGAGGTCAGGGGG - Intronic
1005355718 6:24981468-24981490 TGGGGGCTGTGGGGGTCAGGAGG - Intronic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1005728991 6:28677397-28677419 AGGTCGGTTGGGGCGTCAGGGGG - Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1006470484 6:34226054-34226076 TGGAGGGTCTGGGGGTGGGGTGG - Intergenic
1006518709 6:34559049-34559071 CGGTGGATCAGGGGGTCAAGAGG - Intergenic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006893299 6:37448268-37448290 AGGTGAGTCTGGGTGTCCAGGGG + Intronic
1007073756 6:39054041-39054063 AGGTGGGGCTGGGGTGAAGGGGG - Intronic
1007081511 6:39108414-39108436 AGATGGGTGTGGGGGTGGGGGGG + Intronic
1007400149 6:41598713-41598735 GGGTGAGTTTGGGGGGCAGGGGG + Intronic
1007412877 6:41674938-41674960 GGGTGGGTGTGTGGGTGAGGAGG + Intergenic
1007426238 6:41748025-41748047 AGGGGTGTCAGGGGGTCAAGAGG + Intronic
1007563863 6:42833272-42833294 AGGTGGATCACGAGGTCAGGAGG - Intronic
1008276455 6:49549759-49549781 AGGTGGGTGTGTGGGTAGGGTGG + Intergenic
1008816002 6:55567503-55567525 AGGTGGATGTGAGGGTCAGGTGG - Intronic
1010029262 6:71256165-71256187 GGGTGGGGCTGGGGGTGGGGTGG + Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010231849 6:73541841-73541863 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1010746316 6:79566056-79566078 AGGTTAGTCTTGGGGTGAGGAGG + Intergenic
1011825719 6:91303282-91303304 AGGTGGGCTTCTGGGTCAGGTGG - Intergenic
1012251022 6:96980999-96981021 TGGTGGGGCGGGGGGGCAGGCGG + Intronic
1013369881 6:109459456-109459478 AATTGGGTGTGGGGGTCAGGTGG + Intergenic
1013478409 6:110530749-110530771 AGGAGAGTTTGGTGGTCAGGGGG + Intergenic
1013598371 6:111681607-111681629 AGGTGGGACTGGAGCTGAGGAGG - Intronic
1014490215 6:122053382-122053404 AGGTGGGGCTGCGGGGCAGGAGG + Intergenic
1014964372 6:127728717-127728739 AGTTGGGATTGGGGGTGAGGTGG + Intronic
1015018408 6:128442400-128442422 AGGTGGGTATGGGGTCTAGGAGG - Intronic
1016051247 6:139532817-139532839 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1017198288 6:151725310-151725332 ATGTGGTTGTGGGGGGCAGGGGG + Intronic
1017715808 6:157212224-157212246 GCGTGGGGCTTGGGGTCAGGAGG - Intergenic
1017784826 6:157746909-157746931 GGGTGGGTCGTGGGGTCAGAGGG + Intronic
1018061613 6:160094055-160094077 AGGTAGGGCTGGTGGACAGGAGG - Intronic
1018639940 6:165896748-165896770 AGGTGGATCACGAGGTCAGGAGG - Intronic
1019101600 6:169635223-169635245 AGGTGTGGTTGGGGGGCAGGTGG + Intronic
1019455705 7:1126132-1126154 AGGTGGATCACGAGGTCAGGAGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019561599 7:1662046-1662068 GGATGGGTCCGGGGGTCGGGGGG + Intergenic
1019615130 7:1955978-1956000 AGGTGGGTGGGGGGGTGGGGTGG + Intronic
1019686468 7:2384671-2384693 AGGTGAGGCTGGGGCTCAGGGGG + Intergenic
1019925807 7:4191226-4191248 GGGAGGGCCTGGGGGCCAGGAGG - Intronic
1019936853 7:4263111-4263133 GGGTGGGTGTGGGGGTGATGAGG - Intronic
1019940071 7:4282742-4282764 AGGGTGGTGTGGGGGGCAGGTGG + Intergenic
1020424583 7:8050060-8050082 AGGTGAATCTGGGGGTTCGGGGG + Intronic
1022472969 7:30693001-30693023 GGGTGGCTGTGGGGCTCAGGAGG + Intronic
1022487906 7:30794505-30794527 AGGTGGGGTTAGGGGGCAGGTGG + Intronic
1022702608 7:32775835-32775857 AGGTGGGTCTGTAAGGCAGGAGG - Intergenic
1023258697 7:38336863-38336885 ATGGGTGTGTGGGGGTCAGGAGG + Intergenic
1023350238 7:39313211-39313233 TGATGGGTCTGGGGATCAGGAGG - Intronic
1023381186 7:39609901-39609923 AGGTGCCTCTGGCGGCCAGGCGG - Intronic
1023511942 7:40962381-40962403 AGCTGGGTTTCTGGGTCAGGTGG - Intergenic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863106 7:44227099-44227121 AGGTGGATGTGGGGGACAGAGGG + Intronic
1023863233 7:44227470-44227492 AAGGGGGTATGGGGGGCAGGGGG + Intronic
1023863244 7:44227503-44227525 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863265 7:44227559-44227581 AGGAGGGTCTGGGGGGCAGAGGG + Intronic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863328 7:44227747-44227769 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863341 7:44227786-44227808 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1024234425 7:47387241-47387263 AGGTGGGGCTGGGGCTGTGGAGG + Intronic
1024817635 7:53289330-53289352 AGGTGGGTTTGAGGGGCAGAAGG - Intergenic
1025216436 7:57060547-57060569 AGGGAGGGCTGGGGGCCAGGTGG - Intergenic
1025627186 7:63232998-63233020 AGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1025654946 7:63510183-63510205 AGGGAGGGCTGGGGGGCAGGTGG + Intergenic
1025936910 7:66044840-66044862 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026884905 7:73934876-73934898 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1026930523 7:74220782-74220804 AGGTGGGGCAGGGGGAGAGGTGG - Intronic
1026930531 7:74220799-74220821 AGGTGGGGCAGGGGGAGAGGTGG - Intronic
1028151754 7:87381655-87381677 TGGTGGGGCTTGGGGTCATGAGG - Intronic
1028192214 7:87866721-87866743 AGGTGGGAGTGGGTTTCAGGAGG - Intronic
1028983720 7:96993860-96993882 AGGTGTGGCTGGGGATGAGGTGG - Intergenic
1029428813 7:100515855-100515877 AGGGAGGTCTGGGGGCCTGGAGG - Intergenic
1029452244 7:100647570-100647592 AGGTGGGGGTGGGGGTCAGGTGG - Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029576996 7:101410077-101410099 AGGTTGGTTTGGTGGGCAGGGGG + Intronic
1031383241 7:121114054-121114076 AGGTGGATCACGAGGTCAGGAGG - Intronic
1031549197 7:123087257-123087279 GGGTGTGTTGGGGGGTCAGGGGG + Intergenic
1031869365 7:127075504-127075526 ATGTGGGGCAGGGGGTCGGGGGG + Intronic
1032125465 7:129189496-129189518 AGCCGGGTCTGGGGGGCGGGAGG + Intronic
1032305454 7:130729852-130729874 AGGCAGGTCTGGGGCTCAGCAGG + Intergenic
1032387499 7:131534540-131534562 AGGGTGGGGTGGGGGTCAGGAGG + Intronic
1032701128 7:134380244-134380266 AGGTGGGACTGCGGATCAGTTGG + Intergenic
1033322457 7:140352228-140352250 AGGTGGGGGTGGGGGAGAGGTGG + Intronic
1033580790 7:142733333-142733355 AGGTGGGTCGGGGAGACAGATGG - Intergenic
1033756967 7:144403823-144403845 GGGTGGGGGTGGGGGTGAGGGGG - Intronic
1034069691 7:148172240-148172262 AGGTGGTGCTGGGGGCCAGCAGG + Exonic
1034277764 7:149831085-149831107 AGGTGGGGGTGGGGCACAGGAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034449353 7:151129124-151129146 AGGAGGGTCTGGTGGCCACGTGG + Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1034948566 7:155280763-155280785 AGATGGGGCTGGGGGTGGGGAGG - Intergenic
1035062585 7:156080073-156080095 AGGTGGTGCTGGGGGTGGGGTGG - Intergenic
1035259578 7:157652959-157652981 AGGGGGCTCTCGGGGCCAGGAGG + Intronic
1035259758 7:157653871-157653893 GGGTGGGTGTGGGGATCAGCGGG - Intronic
1035266624 7:157693065-157693087 AGGTGGCGCTGGGGGGCGGGGGG + Intronic
1035270784 7:157718859-157718881 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035271079 7:157720357-157720379 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035406801 7:158604120-158604142 AGGTGGGTGTGGGGCAGAGGAGG - Intergenic
1035527499 8:325296-325318 AGCTGGGTGTGGAGATCAGGGGG - Intergenic
1036798043 8:11769926-11769948 ACGCGGGTCTGAGGGTCAGTGGG - Exonic
1037907304 8:22723144-22723166 AGGTGGGTCAAGGGGTGGGGTGG + Intronic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038495511 8:27999391-27999413 AGGTGGGCATGGGGGTGAGAGGG - Intergenic
1039048285 8:33470017-33470039 AGGTGGATCACGAGGTCAGGAGG - Intronic
1039906104 8:41787444-41787466 AGGTTGGGCTGGGGGTTGGGGGG - Intronic
1040570707 8:48606680-48606702 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1040982425 8:53257253-53257275 AAGTGGGTCTGGAGGACAAGTGG + Intergenic
1041737347 8:61125307-61125329 TGGATGGTTTGGGGGTCAGGGGG + Intronic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042435162 8:68755833-68755855 AGGTGGATCACGAGGTCAGGAGG + Intronic
1045412457 8:101932312-101932334 AGTTGTATCTGGGGGTTAGGAGG - Intronic
1045435279 8:102157159-102157181 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1045510386 8:102808404-102808426 AGTTGGGTCTGAAGGCCAGGAGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048298621 8:133235103-133235125 AGGTGGATCACGAGGTCAGGAGG - Intergenic
1048712054 8:137223488-137223510 AGGTGGATCATGAGGTCAGGAGG + Intergenic
1048787502 8:138065968-138065990 AGGTGGGGATGAGGGGCAGGTGG - Intergenic
1049252952 8:141598925-141598947 GGCAGGGTCTAGGGGTCAGGTGG - Intergenic
1049363439 8:142225150-142225172 AGGAGGGTCTGGGGGGAGGGGGG - Intronic
1049392457 8:142379296-142379318 ATTTGAGTCTGGGGGTTAGGAGG - Intronic
1049608119 8:143539106-143539128 AGGAGGGTCTGAGGGTCCCGGGG + Exonic
1049661750 8:143822621-143822643 AGGTGGGCCTGGGGACCAAGAGG + Intronic
1050944195 9:11497834-11497856 AGGGGTGTTTGGGGGTCGGGTGG + Intergenic
1051160441 9:14201356-14201378 AGTTGGGTGTGGGTGTGAGGGGG - Intronic
1051516430 9:17935237-17935259 AGGAGGGTGTGGGGTTCTGGAGG - Intergenic
1051894722 9:21975175-21975197 AGGGCGGTGTGGGGGGCAGGTGG - Intronic
1053054819 9:34988127-34988149 AAGTGGGGTTGGGGGCCAGGAGG - Intergenic
1053360959 9:37486355-37486377 TGGTGGGTGAGGGGGTCAGCAGG - Intronic
1053473387 9:38363466-38363488 GGGTGGGTCTGTGAGCCAGGAGG + Intergenic
1053655798 9:40217338-40217360 AGGTGTGTCGGGAGGTCGGGAGG + Intergenic
1054367915 9:64363565-64363587 AGGTGTGTCGGGAGGTCGGGAGG + Intergenic
1054456170 9:65431608-65431630 AGGTGGGCCTGGAGCTAAGGGGG - Intergenic
1054528809 9:66158952-66158974 AGGTGTGTCGGGAGGTCGGGAGG - Intergenic
1054675532 9:67853309-67853331 AGGTGTGTCGGGAGGTCGGGAGG + Intergenic
1054866513 9:70007705-70007727 ATGTGGGTCTGGGTTTAAGGGGG + Intergenic
1056446859 9:86674768-86674790 ACATGGGTCTGGGGGTCAGCTGG - Intergenic
1057436338 9:95044379-95044401 AGGTGGGGGTGGGAGTGAGGGGG + Intronic
1057495280 9:95555519-95555541 TGGTGTGTCTGAGGGACAGGAGG - Intergenic
1057658571 9:96979012-96979034 AGGTGGATCACGAGGTCAGGAGG + Intronic
1058411693 9:104740342-104740364 AGGTGGATCATGAGGTCAGGAGG - Intergenic
1059384786 9:113955902-113955924 AGGGTGCTTTGGGGGTCAGGAGG + Intronic
1060407508 9:123380102-123380124 AGGGGTGTCTGGGGGACAAGGGG - Exonic
1060479152 9:124007903-124007925 AGGCGGGTCTGGGGCCAAGGAGG + Intronic
1061168155 9:128936512-128936534 AGGTGGGGGTGAGGGCCAGGAGG + Intronic
1061183565 9:129038728-129038750 AGGTGAGGCTGGGGGGAAGGTGG + Intronic
1061230280 9:129311938-129311960 GGGTGGGGCGGGGGGTCGGGGGG + Intergenic
1061295339 9:129673963-129673985 ACGTGGGGCAGGGGGGCAGGTGG + Intronic
1061395981 9:130343519-130343541 GGGAGGGTCGGGGGGCCAGGTGG - Intronic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1061537375 9:131258461-131258483 AGGTGGGTCAGGGGGCAAGGTGG + Exonic
1061588264 9:131582569-131582591 AGGCGGGGCTGGGGGCCTGGAGG + Intronic
1061626354 9:131842807-131842829 AGGGGCGTCTCGGGGGCAGGCGG - Intergenic
1061645265 9:131995895-131995917 ACTTGGGTCTGGGAGTCAAGGGG + Intronic
1061660674 9:132128192-132128214 AGCTGGGTCTGGGGGACTCGAGG - Intergenic
1061885584 9:133589725-133589747 AGGTGAGGGTGGGGGTCACGAGG - Intergenic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062432247 9:136531439-136531461 GGGTGGGGCTGGGGGTGCGGGGG - Intronic
1062510439 9:136902378-136902400 AGGAGTGTCTGGGGGACAGGTGG + Intronic
1062581808 9:137232160-137232182 AGGTGGGTCTGGAGGTTCCGGGG + Exonic
1062708765 9:137960293-137960315 AGGTCGGTCTGAGGGACACGGGG + Intronic
1185473225 X:397634-397656 TGGAGGGTGTGGGGGGCAGGAGG - Intergenic
1186536614 X:10356528-10356550 AGGTGGGGATGGGGTTAAGGAGG + Intergenic
1187174906 X:16887560-16887582 AGGTTAGTCTGGGGGTGTGGGGG - Intergenic
1187263103 X:17705243-17705265 AGGTGGGGCTGTTGGACAGGAGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187425064 X:19170352-19170374 AGGTGGAGGTGGGGGTCAAGAGG + Intergenic
1188146160 X:26616521-26616543 AGGTGGGGCTTGGTGTCATGGGG - Intergenic
1188651556 X:32636770-32636792 AGGTGGATCACGAGGTCAGGAGG + Intronic
1188669234 X:32862961-32862983 AGGTGGATCACGAGGTCAGGAGG - Intronic
1190165728 X:48071525-48071547 AGGTGCGTTTGGGGGCCCGGGGG + Exonic
1190249136 X:48708898-48708920 AGGTTAGTCTGGGGGGCCGGCGG - Exonic
1190290466 X:48988971-48988993 AGGTGGGTCTGAGGCTCCTGAGG - Intronic
1190869869 X:54415787-54415809 AGGCAGGGCAGGGGGTCAGGGGG - Intergenic
1192194335 X:69018493-69018515 AGGAAGCTCTGGGGGCCAGGGGG + Intergenic
1192473486 X:71419734-71419756 AGGTGGGTGTGGGTGGTAGGAGG - Intronic
1193216998 X:78875446-78875468 TGGTGGGTCTGGGTGCCTGGAGG + Intergenic
1193445638 X:81598291-81598313 AGTGGGTTCTGGGGGACAGGCGG - Intergenic
1193581422 X:83268288-83268310 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1194104553 X:89752879-89752901 AGGGAGGTCTGGGGCTCAGGAGG + Intergenic
1196634929 X:117991564-117991586 AGGTGGGGCTGGGGGTTGAGGGG - Intronic
1196805870 X:119585389-119585411 AGGTGGATCATGAGGTCAGGAGG - Intergenic
1196812927 X:119642957-119642979 AGGTGGGTGTGGGGTGGAGGTGG + Intronic
1196887907 X:120264769-120264791 GGGTGGGTCTGTGCTTCAGGTGG + Intronic
1196941833 X:120784751-120784773 GGGTGGATCACGGGGTCAGGAGG + Intergenic
1198393930 X:136204664-136204686 AGGGGGGTCTGTGTGTCAGCAGG + Intronic
1199115749 X:143990023-143990045 AGGTGGATCACGAGGTCAGGAGG + Intergenic
1199712552 X:150480521-150480543 AGGTGAGCCTGTGGGTGAGGTGG - Intronic
1200038599 X:153349366-153349388 AGATGAGACTGGTGGTCAGGAGG - Exonic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200222375 X:154397564-154397586 GGGTGCGTCTGGGGGTCGTGGGG - Intronic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic
1200456508 Y:3400658-3400680 AGGGAGGTCTGGGGCTCAGGAGG + Intergenic
1201742371 Y:17337605-17337627 AGGTGTCACTGGGGGTCAGCAGG + Intergenic
1202079793 Y:21072431-21072453 AGGTGGAGCTGGGCCTCAGGTGG + Intergenic