ID: 1083682234

View in Genome Browser
Species Human (GRCh38)
Location 11:64356997-64357019
Sequence TGAGATCTGCTTCCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083682234_1083682237 5 Left 1083682234 11:64356997-64357019 CCTCCTGAGGGAAGCAGATCTCA 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1083682237 11:64357025-64357047 GCCTTTCCCTCTAGGCCCTGAGG 0: 1
1: 0
2: 1
3: 16
4: 230
1083682234_1083682240 11 Left 1083682234 11:64356997-64357019 CCTCCTGAGGGAAGCAGATCTCA 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1083682240 11:64357031-64357053 CCCTCTAGGCCCTGAGGTACAGG 0: 1
1: 0
2: 2
3: 6
4: 114
1083682234_1083682236 -3 Left 1083682234 11:64356997-64357019 CCTCCTGAGGGAAGCAGATCTCA 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1083682236 11:64357017-64357039 TCAGCTGAGCCTTTCCCTCTAGG 0: 1
1: 0
2: 1
3: 14
4: 235
1083682234_1083682242 17 Left 1083682234 11:64356997-64357019 CCTCCTGAGGGAAGCAGATCTCA 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1083682242 11:64357037-64357059 AGGCCCTGAGGTACAGGAACCGG 0: 1
1: 0
2: 2
3: 22
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083682234 Original CRISPR TGAGATCTGCTTCCCTCAGG AGG (reversed) Intronic
900867575 1:5279384-5279406 GGAGATCTGCTGCCTTCTGGAGG - Intergenic
902459431 1:16561795-16561817 CGAGACCTGATTCCCTCATGAGG + Intergenic
902592669 1:17486196-17486218 TGTGGTCTGCCTCCCTGAGGTGG - Intergenic
903152628 1:21422476-21422498 CGAGACCTGATTCCCTCATGAGG + Intergenic
903160501 1:21485509-21485531 CGAGACCTGATTCCCTCATGAGG - Intergenic
906102320 1:43271514-43271536 TGAGACATGCTTTCCTCTGGAGG + Intronic
907119389 1:51995016-51995038 TGTGTTGTTCTTCCCTCAGGTGG - Intergenic
908991318 1:70094029-70094051 TTAGTTCTTCTTCCCTCAGATGG - Intronic
912272130 1:108221855-108221877 CGAGACCTGATTCCCTCATGAGG + Intergenic
913588094 1:120296312-120296334 AGCCATCTGCTTCCTTCAGGGGG + Intergenic
913606152 1:120468359-120468381 CGAGACCTGATTCCCTCATGAGG - Intergenic
913620091 1:120602057-120602079 AGCCATCTGCTTCCTTCAGGGGG - Intergenic
913989092 1:143593066-143593088 TGAGATCCAATTCCCTCAGGAGG + Intergenic
914210279 1:145571793-145571815 CGAGACCTGATTCCCTCATGAGG + Intergenic
914269198 1:146064155-146064177 CGAGACCTGATTCCCTCATGAGG + Intergenic
914367898 1:146996710-146996732 CGAGACCTGATTCCCTCATGAGG - Intergenic
914485081 1:148101498-148101520 CGAGACCTGATTCCCTCATGAGG + Intergenic
914570111 1:148908185-148908207 AGCCATCTGCTTCCTTCAGGGGG + Intronic
914585045 1:149053482-149053504 CGAGACCTGATTCCCTCATGAGG + Intergenic
914602718 1:149222084-149222106 AGCCATCTGCTTCCTTCAGGGGG - Intergenic
917445891 1:175105623-175105645 TAATTTGTGCTTCCCTCAGGTGG + Intronic
918145733 1:181753988-181754010 TGAGAAGTGCTTCCTCCAGGGGG - Intronic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
922799152 1:228356519-228356541 TGAGACCTGCTTTCCTCAGTGGG + Intronic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
1062787686 10:278849-278871 TGAGGTCTGCTTGGCTGAGGAGG + Intronic
1063515651 10:6692481-6692503 TGACATATCCTTCCGTCAGGAGG + Intergenic
1067142049 10:43666462-43666484 TGAGGTCCCCTTCTCTCAGGAGG - Intergenic
1071181237 10:82985958-82985980 GGAGAGCTGCATCCCGCAGGTGG + Intronic
1071477528 10:86037529-86037551 TAAGATGTGCTTCCCTTAGAAGG + Intronic
1072803122 10:98407208-98407230 TGAGAGCTGCTTCCCTCTCTTGG - Intronic
1076506983 10:130984777-130984799 TGTGCTCTGCTGCCCTCATGGGG - Intergenic
1076778001 10:132708877-132708899 TGTTATCTGCTTTCCTAAGGTGG + Intronic
1078907151 11:15698065-15698087 TGAGATCTGATTACTTCATGTGG + Intergenic
1079769909 11:24445921-24445943 GGTGATCTGCTTCCCTCAAATGG + Intergenic
1079933867 11:26594872-26594894 TAATATATACTTCCCTCAGGGGG + Intronic
1080013095 11:27477764-27477786 TTAGCTGTGCTTCCCTCAGAAGG + Intergenic
1083297311 11:61721973-61721995 GGAGATCTGCTGGCCTCATGGGG - Intronic
1083360913 11:62107396-62107418 TGATTTCTGCTTCCCTGTGGTGG - Intergenic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1085136168 11:74090784-74090806 TGAGAATTGCTTGTCTCAGGTGG + Intronic
1085640950 11:78192337-78192359 TGCACTCTGCCTCCCTCAGGAGG - Intronic
1086317313 11:85608377-85608399 TAAGTTATACTTCCCTCAGGTGG - Intronic
1094159881 12:27379386-27379408 TGAGATCTCATTCCCTCACAAGG - Intronic
1095143322 12:38693670-38693692 TGAGATATCCTTCCATCTGGAGG + Exonic
1099257795 12:80336109-80336131 TGATATCTGCTGCCCTGAGTGGG + Exonic
1100697195 12:97107779-97107801 GGCAATCTGCTTCCTTCAGGAGG + Intergenic
1103149459 12:118624268-118624290 TGGGATCTGCATTCCTCTGGGGG + Intergenic
1106948391 13:34854531-34854553 TGTGATCTGCTTACTTCAGTGGG + Intergenic
1107687004 13:42911462-42911484 TGAGAATTACTTCCCCCAGGAGG - Intronic
1109181746 13:59222283-59222305 TGATTTCTGCAACCCTCAGGTGG - Intergenic
1112530293 13:100195186-100195208 TGTGATCAGCTTCCATGAGGAGG + Intronic
1113639313 13:111945855-111945877 TGCCATCTGCTTCCCTCACAAGG + Intergenic
1116640140 14:47451205-47451227 AGAGATCTTCTTCCCTGAGTAGG - Intronic
1118916000 14:70106667-70106689 TGAGATCTTCTTCCATGATGAGG - Intronic
1119988350 14:79166199-79166221 TGAAATCTTCTTCCCTTTGGTGG + Intronic
1120537547 14:85715474-85715496 AGCAATCTGCTTCCTTCAGGGGG + Intergenic
1121747664 14:96312520-96312542 TGAGAACTCCTGGCCTCAGGTGG - Intronic
1122825127 14:104367077-104367099 TGTGAACTTCTTCCTTCAGGAGG - Intergenic
1124231586 15:27951160-27951182 TGAGATGTGGCTCTCTCAGGGGG - Intronic
1124373386 15:29115873-29115895 CGAGACCTGCTTGCCTGAGGAGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1131824341 15:96305898-96305920 AGAGATTTGCTTCCCTGAGTTGG - Intergenic
1132009674 15:98265339-98265361 TGGGAGCTCCTTCCCTGAGGTGG - Intergenic
1132299398 15:100766939-100766961 AGAGATGTGCTTCCCTCTGGGGG - Intergenic
1132882410 16:2168221-2168243 TGGGACCTGGTTCCCCCAGGAGG - Intronic
1134111321 16:11517091-11517113 TGAGAGCTGCTCTCCCCAGGTGG - Intronic
1135339750 16:21635583-21635605 TAATTTCTACTTCCCTCAGGTGG + Intronic
1135790989 16:25395701-25395723 TTAGGTATGCTTCCATCAGGTGG + Intergenic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1139011966 16:62645514-62645536 TAATATCGGCTTCCATCAGGGGG - Intergenic
1139835271 16:69833424-69833446 TGATATGTGTTTCCATCAGGAGG + Intronic
1140432877 16:74919742-74919764 GGACTACTGCTTCCCTCAGGAGG + Intronic
1143100649 17:4502967-4502989 TGAGGCCTGCTGCCCTCAGGGGG - Intronic
1144947686 17:18978177-18978199 TGAGAACGGCCTCCCCCAGGGGG - Exonic
1146362924 17:32193484-32193506 AGATATCTCCTTCCATCAGGTGG - Intronic
1146782043 17:35682828-35682850 AGAGATTTACTTCACTCAGGTGG + Intronic
1149159698 17:53676982-53677004 AGAGATATGATTCCTTCAGGAGG - Intergenic
1149352828 17:55809348-55809370 TGACATCTGCTTACCTTAAGGGG - Intronic
1149813470 17:59700869-59700891 TCTGAGCTCCTTCCCTCAGGGGG - Exonic
1152664068 17:81557185-81557207 TGAGACCTCCTTCCCACAAGAGG + Exonic
1152722570 17:81930078-81930100 TGAGATCTGCTGCTCTCAGGAGG - Intergenic
1153065316 18:1039124-1039146 AGCAATCTGCTTCCTTCAGGGGG - Intergenic
1153823835 18:8856520-8856542 CGAGTTCTGCTTCGCTTAGGAGG + Intergenic
1154228643 18:12532987-12533009 AGAGATCGGCTTCCCGCAGGAGG + Intronic
1155625404 18:27828777-27828799 TCAAATCTGCTTCCCTAAGGAGG + Intergenic
1156368532 18:36451720-36451742 TGAAATCAGCTTCTCTGAGGTGG + Intronic
1157777002 18:50403548-50403570 TGAGATCTGAACTCCTCAGGTGG + Intergenic
1161824113 19:6551124-6551146 TGAGACCTGCAGCCATCAGGAGG - Intergenic
1161865903 19:6832071-6832093 TGAGCTCTGCTTCCCTGCAGTGG + Exonic
1163234761 19:16023850-16023872 TGAGTCCTGCTACCCCCAGGTGG + Intergenic
1165953264 19:39486543-39486565 TGGGCCCTCCTTCCCTCAGGTGG - Intronic
1166130007 19:40740435-40740457 TCAGAGCTGCTGCACTCAGGAGG + Exonic
1166261117 19:41641774-41641796 TAAGATTTGCTTCAGTCAGGAGG + Intronic
1168708117 19:58481050-58481072 TGGGACCTCCTTGCCTCAGGTGG + Exonic
1202675676 1_KI270711v1_random:3979-4001 CGAGACCTGATTCCCTCATGAGG + Intergenic
925237433 2:2292063-2292085 TGGGCTCTGCTTCCCTCTGTTGG + Intronic
925350475 2:3197792-3197814 TGGGAACTGTGTCCCTCAGGAGG - Intronic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929010232 2:37434815-37434837 TGCAATCTGCTTCCTTCAGATGG + Intergenic
930248752 2:49012006-49012028 TGACATGTGCTTTCTTCAGGTGG - Intronic
932588996 2:73051799-73051821 TGAGGTCTGCATCCTTCAGAGGG + Intronic
935261762 2:101361934-101361956 TGAGATCTGTTACCCAGAGGAGG - Intronic
936105907 2:109624163-109624185 TGAGATAACCTTCACTCAGGTGG + Intergenic
936280422 2:111135514-111135536 TGGGGTCAGCTTCCCTCAGAGGG - Intronic
937151068 2:119686033-119686055 TGAGATCCCCTTTCCTCAGCTGG - Intronic
937933485 2:127223346-127223368 TGAGTGCTACTTCCTTCAGGAGG - Intergenic
938244225 2:129764965-129764987 AGAGTTCTGCTTTCCTCAGGAGG - Intergenic
938324082 2:130385973-130385995 TGAGATGTGCTTAACTCAGCTGG + Intergenic
938806260 2:134809398-134809420 TGCAATCTGCATCCCACAGGAGG - Intergenic
940282940 2:152006228-152006250 TGAGATCTGAATGTCTCAGGTGG + Intronic
940321529 2:152382461-152382483 TGAGATCTGCTTTTCTCACCAGG - Intronic
942185537 2:173421587-173421609 TGAGTGCTGCTTTCCTCAGCCGG + Intergenic
946051785 2:216868948-216868970 TGAGATGAGGTTCCCTCAAGCGG - Intergenic
947457226 2:230265821-230265843 TGCAATCTGCTTCCTTCAGAGGG + Intronic
1168841353 20:912043-912065 GAAGATGTGCTGCCCTCAGGTGG + Intronic
1169406131 20:5322769-5322791 TGAAATCTTCCTGCCTCAGGAGG + Intergenic
1170302642 20:14902813-14902835 TGTGATCTGTTTCCCTCATGTGG - Intronic
1171251542 20:23652959-23652981 TGAGATCTGTGTCCTTCAGAGGG + Intergenic
1172315948 20:33954483-33954505 TGAGATCTGCTTCACTAAGAGGG + Intergenic
1174139528 20:48403386-48403408 TGAGAACTGCAACCCTCTGGTGG + Intergenic
1175746427 20:61460370-61460392 TGAGACCAGCTTCTCTCAGCTGG + Intronic
1176332145 21:5558964-5558986 TGAGAGTTTCTTCCCTCTGGTGG + Intergenic
1176395612 21:6261987-6262009 TGAGAGTTTCTTCCCTCTGGTGG - Intergenic
1176441545 21:6727117-6727139 TGAGAGTTTCTTCCCTCTGGTGG + Intergenic
1176465807 21:7054186-7054208 TGAGAGTTTCTTCCCTCTGGTGG + Intronic
1176489368 21:7435964-7435986 TGAGAGTTTCTTCCCTCTGGTGG + Intergenic
1181055266 22:20257962-20257984 TCAGAACTGCTTCCCTCAGTTGG + Intronic
1181693737 22:24582478-24582500 TGAGGTCTGTTCCCCACAGGAGG + Intronic
1181761041 22:25059027-25059049 TGATATCTGCCTCCCTCATCAGG + Intronic
1181948567 22:26538045-26538067 TAAGATCTGCATCATTCAGGTGG - Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184689221 22:46109954-46109976 TCACATCTGCTTCTCCCAGGTGG + Intronic
1185385410 22:50529547-50529569 TGATGTCCGCTTCGCTCAGGCGG + Exonic
950361492 3:12452560-12452582 TGAGATCTGATGGCCTCTGGGGG - Intergenic
950371474 3:12534404-12534426 TCAGCTCTGCTTCCCTGTGGTGG + Intronic
950628758 3:14267453-14267475 TGAAATCTTCTTCCCAGAGGAGG + Intergenic
950882083 3:16330064-16330086 TGACATCTCCTACCCTGAGGGGG - Intronic
954388204 3:50255375-50255397 TGAAATCTGGGTTCCTCAGGGGG - Intronic
954444124 3:50537479-50537501 TGAGTTCTGCCTCCTCCAGGAGG - Intergenic
955060791 3:55489823-55489845 TGAGATCTGCCCACCTGAGGAGG + Intronic
955477502 3:59353229-59353251 AGCAATCTGCTTCCTTCAGGGGG + Intergenic
955676077 3:61450163-61450185 TCAGTTCTGCTTCTCTCAGAGGG - Intergenic
955798207 3:62659758-62659780 TGAGCTCTTCTTCACCCAGGTGG - Intronic
956726415 3:72160256-72160278 TCAGAAGTGCTTCCCTCAGAGGG - Intergenic
956975188 3:74570728-74570750 TGAGGTCTTCCTCCCTCAGCCGG + Intergenic
957612619 3:82487862-82487884 TGAGATATGCTTTCCTCTGGTGG + Intergenic
957778506 3:84787753-84787775 TGAGGTCTGCTTCTTTCTGGAGG - Intergenic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
961614345 3:128167025-128167047 TGAGATCTCAACCCCTCAGGAGG - Intronic
962839094 3:139217601-139217623 TGAGGTCTGGATCTCTCAGGAGG - Intronic
964235191 3:154517716-154517738 TGGGATATGCTTCCATCATGTGG + Intergenic
968125614 3:196157821-196157843 AGCGATCTGCTTCCTTCATGGGG + Intergenic
971578379 4:28304893-28304915 TAATATATACTTCCCTCAGGTGG - Intergenic
973787587 4:54347991-54348013 AGTGATCTGCCTGCCTCAGGCGG + Intergenic
980153170 4:129073211-129073233 TGCAATCTGCTTCCTTCAGAGGG + Intronic
984579014 4:181488149-181488171 TGAGATCTGTTTCCCTGAAATGG + Intergenic
984723630 4:182999854-182999876 TAATATATACTTCCCTCAGGAGG - Intergenic
984878979 4:184393808-184393830 AGAGAACTGCTCCCCTCAGGGGG - Intronic
985495154 5:199999-200021 GGAGATCTGCTTTCCCCATGGGG + Exonic
986430315 5:7674446-7674468 AGAGATCTGCTCCCCTCCAGGGG - Intronic
986801380 5:11263957-11263979 TGAAATCGTCTTCCCTCTGGTGG + Intronic
990572648 5:57094708-57094730 AGCAATCTGCTTCCTTCAGGAGG - Intergenic
992405663 5:76455214-76455236 TGAGGTGGGCATCCCTCAGGAGG + Intronic
993308414 5:86298134-86298156 CGAGATCTGATTCCCTCATGAGG - Intergenic
993979293 5:94525043-94525065 TTAGATATGCTGCCATCAGGTGG - Intronic
995955198 5:117769229-117769251 AGCAATCTGCTTCCCTCAGGGGG - Intergenic
996623594 5:125541184-125541206 TGACCTCTGGTTCCCACAGGAGG + Intergenic
997364272 5:133315635-133315657 TGAGATCAGCCTCCCTGAGTTGG - Intronic
999717104 5:154370176-154370198 TGGGACCTGCTTCCCTCACAGGG + Intronic
1001177269 5:169481632-169481654 TGCAATCTGCTTCCTTCAGAGGG + Intergenic
1003557657 6:7155234-7155256 TGAGGCCTGATTCCATCAGGTGG + Intronic
1003956835 6:11172108-11172130 TCAGAGCTTCTTCCCTCTGGTGG - Intergenic
1005297029 6:24436695-24436717 TTACATCTGCTATCCTCAGGGGG + Exonic
1005313431 6:24581265-24581287 TGAGAACTGCTGCCCTCTGCTGG - Intronic
1006455374 6:34128946-34128968 TGGAAACTGCTTCCCTCTGGGGG + Intronic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1007890938 6:45291023-45291045 AGGAATCTGCTTCCTTCAGGGGG - Intronic
1009281216 6:61754034-61754056 TGAGAACTTGTTCCCTCTGGAGG - Intronic
1009470698 6:64026511-64026533 TAATTTGTGCTTCCCTCAGGTGG - Intronic
1009798379 6:68502212-68502234 AGCAATCTGCTTCCTTCAGGGGG - Intergenic
1010074744 6:71786768-71786790 TTAGATCTGCTTGTCTGAGGAGG - Intergenic
1014170914 6:118278218-118278240 TGACATTTGCTACCCTCAGAAGG + Intronic
1016982584 6:149866377-149866399 TGACATCTGCTTCAGCCAGGAGG + Intergenic
1017172275 6:151468364-151468386 TGTGATCTGTCTCTCTCAGGTGG + Exonic
1019723949 7:2590303-2590325 TGAGAGCTGCTTCCCTGGTGAGG - Intronic
1021888495 7:25164254-25164276 GGAGAAATGCTTCCATCAGGGGG + Intronic
1023679083 7:42665204-42665226 TGAGAAATGCTTTCCTCAGCTGG + Intergenic
1023889997 7:44385171-44385193 GGAGAGCTGGTGCCCTCAGGAGG - Exonic
1026294656 7:69040696-69040718 TGAAATTTTCTTTCCTCAGGTGG - Intergenic
1026501411 7:70946315-70946337 GGAGATCTGCTGCCTTCTGGGGG + Intergenic
1028404355 7:90460074-90460096 TGAGATCTAGTGCCCTCAGGCGG + Intronic
1033233341 7:139619055-139619077 TGGTATCTGCTGCCCTCTGGGGG - Intronic
1033601552 7:142892368-142892390 TGACATCTGGTACCCGCAGGAGG + Intergenic
1037822942 8:22143982-22144004 TGACAGCTGCTGCCCCCAGGGGG - Intergenic
1042664495 8:71191022-71191044 TGCCATCTGCCTCTCTCAGGAGG - Intergenic
1043187817 8:77177348-77177370 AGAAATCTGCTTCCTTCAGTTGG - Intergenic
1044744030 8:95355021-95355043 TGAGATCTTCTTCCATTAGCTGG - Intergenic
1044928668 8:97231280-97231302 TGAATTCTGCATCCTTCAGGAGG - Intergenic
1049163495 8:141112318-141112340 TGAGAGCTGCTTCCTGGAGGAGG + Intergenic
1052922926 9:33987052-33987074 AGAGATCTGCCCCCCTCAGCTGG - Intronic
1055458395 9:76493859-76493881 TAATTTCTACTTCCCTCAGGTGG + Intronic
1056804815 9:89720290-89720312 TGAGATCTGTCTCCCACAGGGGG - Intergenic
1060826912 9:126692980-126693002 TAAGATCTCCTTCCCTCCCGTGG - Intronic
1203429953 Un_GL000195v1:81368-81390 TGAGAGTTTCTTCCCTCTGGTGG - Intergenic
1185452829 X:291842-291864 TGAGATCTGCTTCCCTTGACGGG + Intronic
1187163551 X:16785552-16785574 GGAGATCTGGTTCCATCAGATGG + Intergenic
1189007427 X:37010022-37010044 TGAGATACGCTACTCTCAGGAGG - Exonic
1189216115 X:39325924-39325946 TGAGTACTGCTTTCCACAGGGGG + Intergenic
1192328012 X:70149836-70149858 TGAGATATGTTTCCCTAGGGTGG + Intronic
1193991125 X:88308538-88308560 TGAGAGCTGCTTTCCACAGTGGG + Intergenic
1194553538 X:95330657-95330679 TGAGACTTGCTGGCCTCAGGTGG - Intergenic
1195587709 X:106584975-106584997 GGAGAAATGCTTCCATCAGGGGG - Intergenic
1196619593 X:117807015-117807037 AGAGATGTGCTTGCTTCAGGTGG + Intergenic
1197463293 X:126770930-126770952 AGCAATCTGCTTCCTTCAGGGGG - Intergenic
1201057358 Y:10008844-10008866 TGAGTTCTTCTCCCCTCAGCAGG - Intergenic