ID: 1083683488

View in Genome Browser
Species Human (GRCh38)
Location 11:64361909-64361931
Sequence TACAAAGCAGCCGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083683488_1083683495 6 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683495 11:64361938-64361960 CTAAGAAGCGATTGGGCGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1083683488_1083683499 16 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683499 11:64361948-64361970 ATTGGGCGCGGGGCCCCAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 142
1083683488_1083683502 30 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683502 11:64361962-64361984 CCCAGGGGGCACAAGAAGTCCGG 0: 1
1: 0
2: 3
3: 52
4: 457
1083683488_1083683498 15 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683498 11:64361947-64361969 GATTGGGCGCGGGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 10
4: 118
1083683488_1083683496 13 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683496 11:64361945-64361967 GCGATTGGGCGCGGGGCCCCAGG 0: 1
1: 0
2: 1
3: 10
4: 124
1083683488_1083683497 14 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683497 11:64361946-64361968 CGATTGGGCGCGGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 44
1083683488_1083683492 4 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683492 11:64361936-64361958 TCCTAAGAAGCGATTGGGCGCGG 0: 1
1: 1
2: 1
3: 1
4: 35
1083683488_1083683490 -2 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683490 11:64361930-64361952 TAAGGATCCTAAGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 74
1083683488_1083683494 5 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683494 11:64361937-64361959 CCTAAGAAGCGATTGGGCGCGGG 0: 1
1: 0
2: 3
3: 0
4: 30
1083683488_1083683491 -1 Left 1083683488 11:64361909-64361931 CCTGCTGCAGCGGCTGCTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1083683491 11:64361931-64361953 AAGGATCCTAAGAAGCGATTGGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083683488 Original CRISPR TACAAAGCAGCCGCTGCAGC AGG (reversed) Exonic
902039870 1:13484805-13484827 TACAAAACAAACTCTGCAGCTGG + Intronic
902234292 1:15047829-15047851 CACTCAGCAGCCCCTGCAGCTGG + Intronic
902749056 1:18493976-18493998 TGCACAGCAGCAGCAGCAGCGGG + Intergenic
904033514 1:27547503-27547525 TAGCCAGCAGCGGCTGCAGCAGG + Exonic
905325607 1:37149615-37149637 TCCAAAGCGGCAGCAGCAGCTGG + Intergenic
911742684 1:101404276-101404298 TATAAAGAAGACACTGCAGCTGG - Intergenic
912947218 1:114095429-114095451 GACAGAGCAGCGGCTACAGCTGG - Intronic
913533156 1:119747462-119747484 TGCTAAGCAGCGGCTGCAGCTGG + Intergenic
921885464 1:220300459-220300481 TACAAAGCAGCCTCTGCTTGAGG + Intergenic
922206793 1:223455153-223455175 TATAAACCAGCCGCTGCTGGGGG + Intergenic
1067145626 10:43691738-43691760 TACAGAGCAGCTGCTGAAGGAGG + Intergenic
1067904785 10:50279588-50279610 GAACAAGCAGCTGCTGCAGCAGG - Intergenic
1069919228 10:71806212-71806234 GACTATGCAGCCGCTGCAGGTGG + Exonic
1071568920 10:86685933-86685955 TCTTAAGCAGCTGCTGCAGCAGG - Intronic
1076992058 11:280541-280563 TGAAGAGCAGCCGCTGCGGCTGG - Exonic
1077265617 11:1648017-1648039 CACAAAGCAGCAGCAGCCGCTGG + Intergenic
1077407890 11:2390847-2390869 CACAGAGCAGCCGAGGCAGCTGG + Intronic
1079392167 11:20032129-20032151 ACCAAAGCTGCCCCTGCAGCTGG - Intronic
1080977952 11:37364716-37364738 TCCACAGCAACCACTGCAGCTGG + Intergenic
1081526939 11:43933904-43933926 GCCATGGCAGCCGCTGCAGCTGG + Intronic
1083131890 11:60632607-60632629 TCCACAGCTGCCACTGCAGCTGG + Intergenic
1083169439 11:60914315-60914337 GAGACAGCAGCCGCTGCAGGCGG + Intronic
1083683488 11:64361909-64361931 TACAAAGCAGCCGCTGCAGCAGG - Exonic
1083734477 11:64671565-64671587 CACAGAACAGCCACTGCAGCTGG + Intronic
1086989593 11:93288399-93288421 CACAAAGCAGCAGCAGCAGCAGG - Intergenic
1089063701 11:115646244-115646266 TACCAAGCAGCCGCTGCCCAAGG + Intergenic
1097585480 12:61510685-61510707 TTCGAAGCAGCAGCAGCAGCAGG + Intergenic
1099321395 12:81154686-81154708 TTCATAGAAGCTGCTGCAGCAGG + Intronic
1101160952 12:101975703-101975725 CACAAAGCAGCCAATTCAGCAGG + Intronic
1104169834 12:126269391-126269413 TACATAGCAGGCCCTGCAGTGGG + Intergenic
1105015057 12:132781608-132781630 TACAAATCAGGGGCTGCAGCCGG + Intronic
1105893328 13:24697788-24697810 AAAAAAGCAGCAGCAGCAGCTGG + Intronic
1105969038 13:25411245-25411267 GACAAAGCATGAGCTGCAGCAGG - Intronic
1107624273 13:42267132-42267154 TACAAAGGAGCCAGGGCAGCAGG - Intergenic
1107765610 13:43730938-43730960 TAAAGAGCAGCAGCTGCTGCAGG - Intronic
1109426552 13:62171902-62171924 TACAAAACAACCGATGCTGCTGG + Intergenic
1110817042 13:79873126-79873148 TACAAAGCTGGCCCTGCACCTGG - Intergenic
1113922487 13:113921096-113921118 CACATTGCAGCTGCTGCAGCAGG - Intergenic
1116023191 14:39485821-39485843 GACAAAGCAGCCACGGCAACAGG - Intergenic
1116314555 14:43370738-43370760 AACAAAGCAGCCGGGGAAGCTGG + Intergenic
1118359314 14:65042805-65042827 GAGAAAGCAGGCGCTGCAGTGGG - Intronic
1118384157 14:65241448-65241470 TGCAAGGCAGCCACAGCAGCTGG - Intergenic
1118973734 14:70659520-70659542 AAAAAAGCAGCCGCAGCAGGAGG + Intronic
1121526360 14:94621979-94622001 TGCCATGCAGCCACTGCAGCTGG + Intronic
1122413184 14:101536323-101536345 TACACAGCAGGTGCTGCAGCAGG - Intergenic
1128345487 15:66850213-66850235 AACAAAGCAGCCGAGTCAGCTGG + Intergenic
1129157662 15:73728820-73728842 TACAAAGCAGCTTCTGAATCTGG + Intergenic
1131568452 15:93507009-93507031 TTCACAGCAGCCGCTCCAGATGG + Intergenic
1132352057 15:101145913-101145935 CACACAGCAGTCGCTGGAGCAGG - Intergenic
1133046682 16:3092085-3092107 TTCAAAGCAGCCGCTGAGCCCGG - Exonic
1134040433 16:11064291-11064313 TCCAAAGCAGCAGCTGGGGCTGG - Intronic
1136535350 16:30896319-30896341 CCCAAAGCAGCCGCTGCCTCAGG + Intergenic
1138002298 16:53294486-53294508 TACAAAGCAGAAGCAGCACCTGG - Intronic
1139775995 16:69317308-69317330 TCCAAAGCAGCCACTGCCGAAGG - Intronic
1140456093 16:75106425-75106447 TTCAAAGCAGCCTGGGCAGCAGG + Intronic
1142559464 17:801298-801320 TACAAAGCAGCCCCTTCCTCCGG - Intronic
1144676325 17:17164522-17164544 GACACAGCAGGCGCTGCAGCGGG + Intronic
1146628070 17:34448988-34449010 TACTAATCAGCCGCTGAGGCAGG + Intergenic
1147266875 17:39239831-39239853 CACAGAGCAGCAGCGGCAGCTGG + Intergenic
1151869999 17:76830198-76830220 TACAAAGAGGCTTCTGCAGCAGG - Intergenic
1152098054 17:78283954-78283976 TACCAAGAACCCACTGCAGCAGG - Intergenic
1152709708 17:81865173-81865195 TACAAGGCAGAGGCTGCAGTGGG - Intergenic
1154206735 18:12343863-12343885 TATAAAGCAGCAGTTGCAGTGGG - Intronic
1157478322 18:48037217-48037239 TGCAATGCAGCAGCTTCAGCTGG + Intronic
1157740964 18:50092435-50092457 TAGAACGCAGCAGCAGCAGCAGG - Intronic
1160911338 19:1475154-1475176 TGCCAACCAGCGGCTGCAGCAGG - Exonic
1165878313 19:39025190-39025212 CGCAAAGCAGCAGCTGCAGTAGG + Exonic
1166808002 19:45498490-45498512 TCCAGAGGAGACGCTGCAGCTGG - Exonic
1167479323 19:49719832-49719854 TGCGGAGCAGCCGCCGCAGCAGG + Intergenic
926130211 2:10298251-10298273 TCCCCAGCAGCAGCTGCAGCAGG - Intergenic
926594148 2:14771736-14771758 TACAAAGCAGCAGCTGCCTCAGG + Intergenic
927638460 2:24832240-24832262 TCCCAGGCAGCAGCTGCAGCTGG - Intronic
928012842 2:27627103-27627125 CAGGAAGCAGCAGCTGCAGCAGG - Exonic
928742533 2:34371913-34371935 TTCAAAGCAACAGCTGTAGCAGG + Intergenic
928823668 2:35392358-35392380 TGCAAAGATGCGGCTGCAGCGGG - Intergenic
930131612 2:47857842-47857864 TACAAGACAGCCTTTGCAGCTGG + Intronic
931425658 2:62168827-62168849 TTCCAAGCAGCTGCTGCACCAGG - Intergenic
931531628 2:63221295-63221317 TACAAAACAGCTGCTTTAGCTGG - Intronic
935312677 2:101801081-101801103 CAGAAAGCAGCAGCAGCAGCTGG - Intronic
937231016 2:120398270-120398292 CACAGAGCAGCTGCTGCAGTAGG - Intergenic
937388451 2:121459491-121459513 ATCAAAGCAGCAGCAGCAGCAGG - Intronic
938286455 2:130121416-130121438 TGCATGGCAGCAGCTGCAGCTGG + Intronic
938429145 2:131217450-131217472 TGCATGGCAGCAGCTGCAGCTGG - Intronic
938695946 2:133835559-133835581 TGCAAATCAGCCCCTGGAGCAGG + Intergenic
940795397 2:158071897-158071919 TTCATAGTAGTCGCTGCAGCTGG - Intronic
942046806 2:172104000-172104022 CACAAAGCAAGCGCTGCCGCAGG - Intergenic
943226381 2:185184808-185184830 TACACAGCAGCCACTCCAGATGG - Intergenic
943815680 2:192251113-192251135 TTCACAGCACCCTCTGCAGCAGG + Intergenic
947119317 2:226799476-226799498 TACCGGGCAGCCACTGCAGCTGG + Exonic
947178097 2:227387803-227387825 TCCACAGCAGCCACGGCAGCAGG + Intergenic
947197947 2:227587357-227587379 TCCACAGCAGCCGCGGCAGCAGG + Intergenic
947199141 2:227599113-227599135 TCCACAGCAGCCACGGCAGCAGG - Intergenic
947200306 2:227608959-227608981 CCCACAGCAGCCGCGGCAGCAGG - Intergenic
947200993 2:227614658-227614680 TCCACAGCAGCCGCGGCAGCAGG + Intronic
947201399 2:227617673-227617695 TCCACAGCAGCCGCGGCAGCAGG - Intronic
947206613 2:227666919-227666941 CCCACAGCAGCCGCGGCAGCAGG - Intergenic
947212935 2:227724584-227724606 TCCACAGCAGCCGCGGCAGCAGG + Intergenic
947213449 2:227728483-227728505 CCCACAGCAGCCGCGGCAGCAGG - Intergenic
947215489 2:227746060-227746082 TCCACAGCAGCCACGGCAGCAGG - Intergenic
948584682 2:239011940-239011962 TCCAAAGCAGCTGCTCCAACAGG - Intergenic
1174436987 20:50515586-50515608 TATAAAGTAGCAGCTACAGCTGG - Intronic
1175945608 20:62557248-62557270 TTCAAAGCAGGCGCAGCGGCTGG + Intronic
1176030465 20:63008911-63008933 TTCAAAGCATCGGCTGGAGCAGG + Intergenic
1178331259 21:31694812-31694834 TACACAGAAGCCGCATCAGCAGG - Exonic
1179911297 21:44450255-44450277 TAAAATGCAGCTGCTCCAGCTGG - Intergenic
1180652977 22:17394181-17394203 AAAAAAGCAGCGGCAGCAGCTGG - Intronic
1180789363 22:18566169-18566191 TCCCAAGCAGCCACAGCAGCAGG + Intergenic
1181232378 22:21429142-21429164 TCCCAAGCAGCCACAGCAGCAGG - Intronic
1181246273 22:21505715-21505737 TCCCAAGCAGCCACAGCAGCAGG + Intergenic
1181583806 22:23842170-23842192 CACAAAGGAGCCGGTGCAGGAGG + Intergenic
1182460744 22:30481872-30481894 CAAAAAGCAGCAGCAGCAGCAGG + Intergenic
1183219714 22:36504754-36504776 TACAAAGAGGACGCTGCAGGCGG + Exonic
949970627 3:9399914-9399936 TACAAGGCAGCAGCAGCTGCTGG + Intronic
950224511 3:11222888-11222910 TAAAATGCAGACGCTCCAGCCGG + Intronic
952408435 3:33026123-33026145 TACCAAGCTGCAGCTGCAGACGG + Intronic
953483585 3:43273686-43273708 TACAAAGGGACAGCTGCAGCTGG - Intergenic
954767374 3:52930846-52930868 TGTAAAGCAGCCCCTGCAGTCGG - Intronic
955542753 3:59995147-59995169 TACAAATCTGCTGCTGCAACCGG + Intronic
957792478 3:84959021-84959043 GCCACAGCCGCCGCTGCAGCCGG + Intronic
964060026 3:152510216-152510238 TACAAGGCAGCCTCTACAGAAGG - Intergenic
968418762 4:464781-464803 TAAAAAGCAGCAGCTGGGGCTGG + Intronic
969053438 4:4387665-4387687 CACCAAGCAGCCGCTGCTGGAGG + Exonic
972177144 4:36422038-36422060 GACAATGCTGCCTCTGCAGCGGG - Intergenic
982087808 4:151854012-151854034 TTCAAAGCAGCCCTTGCAGAAGG + Intergenic
982658531 4:158178348-158178370 TAGAAAGCAGCAACAGCAGCAGG + Intergenic
983945581 4:173582841-173582863 AACTAAGCAGCTGCTGCACCAGG - Intergenic
985030890 4:185788103-185788125 AACAAAGCAGCAGCTGGCGCTGG - Intronic
985986495 5:3520844-3520866 CACCAGGCAGCTGCTGCAGCAGG + Intergenic
986395167 5:7322023-7322045 TACAGGGCTGCCTCTGCAGCAGG - Intergenic
989100164 5:37815626-37815648 TACACAGCAGTCTCTGGAGCCGG + Intronic
989635712 5:43530806-43530828 TAAACTGCAGCTGCTGCAGCTGG + Intronic
992179770 5:74184540-74184562 TGCAATGCGGCAGCTGCAGCCGG - Intergenic
994149589 5:96432635-96432657 CAGAAGGAAGCCGCTGCAGCTGG - Intronic
994299734 5:98133300-98133322 TACAAAGCAGCAGGTGATGCTGG + Intergenic
996423242 5:123285576-123285598 TAGAACCTAGCCGCTGCAGCGGG + Intergenic
997395045 5:133553037-133553059 GACTAAGTAGCCGCTGCAGTTGG - Intronic
999227814 5:150041813-150041835 TGCACAGCAGCTCCTGCAGCTGG - Exonic
999300854 5:150489493-150489515 TGCAAAGTAGCTGCTGCTGCTGG + Intronic
1002094101 5:176820884-176820906 TAAAGAGCAGGCTCTGCAGCTGG - Intronic
1003865886 6:10362333-10362355 TATAAAGCAGAGGCTGCTGCTGG - Intergenic
1008516926 6:52327274-52327296 AAGAAAGCAGGCGCTGAAGCTGG - Intergenic
1010366297 6:75055595-75055617 TACAAGGCAATGGCTGCAGCAGG + Intergenic
1017326921 6:153150848-153150870 CAAAAAGTACCCGCTGCAGCTGG + Intergenic
1019613799 7:1949744-1949766 CCCCAAGCAGCCGCTGCTGCAGG - Intronic
1020194372 7:6026021-6026043 TCCAGGGCAGCAGCTGCAGCCGG + Intronic
1020896440 7:13945956-13945978 TACCTAGCAGCCTCGGCAGCAGG - Intronic
1028477151 7:91265039-91265061 GCCAAAGCAGCAGCAGCAGCTGG - Exonic
1029438942 7:100576961-100576983 TCCCAAGCAGGGGCTGCAGCGGG - Exonic
1029731559 7:102441737-102441759 TACAGAGCACCAGCTGCAGTGGG + Intronic
1033317086 7:140306292-140306314 CACAAAGCAGAGGCTGCAGTGGG + Intronic
1034417673 7:150973906-150973928 TCCAGAGCCGCCTCTGCAGCCGG + Intronic
1035446547 7:158947073-158947095 GACACAGCAGGCGCTGTAGCAGG - Intronic
1035815055 8:2530087-2530109 TACAAACCGGCTGCTGCACCTGG - Intergenic
1040079052 8:43269615-43269637 TATAAAGCAGCAGCTGCAGTGGG - Intergenic
1043533174 8:81172222-81172244 TACACAGCAGCCACTCCAGACGG + Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1044571318 8:93722332-93722354 TACAAAACACTGGCTGCAGCTGG - Intronic
1045300881 8:100908741-100908763 TTCACAGCAGCCGCTTCAGGCGG + Intergenic
1045320997 8:101081069-101081091 TTCAAAGAACCCGGTGCAGCAGG - Intergenic
1047511343 8:125518149-125518171 TACAAAGGAGCCAGAGCAGCTGG - Intergenic
1048072861 8:131040219-131040241 GCCACAGCAGCCGCTGCGGCCGG + Exonic
1049294380 8:141823313-141823335 TTCATAGCAGCAGCAGCAGCAGG - Intergenic
1049377157 8:142294739-142294761 TACAGAGGAGCTGCTGCTGCAGG + Intronic
1050335781 9:4588918-4588940 TGCAAAGCAAACACTGCAGCTGG - Intronic
1053180247 9:35962278-35962300 TCCTAAGCAGCAGCTGCTGCTGG - Intergenic
1054308381 9:63449023-63449045 GACAAAAAAGCCGCGGCAGCGGG + Intergenic
1058545940 9:106060113-106060135 TACGCAGCAGCCGCTCCAGATGG + Intergenic
1061941919 9:133888393-133888415 AACAAAGCAGCAGCTGCATGTGG + Intronic
1062218714 9:135403062-135403084 CACACAGAAGCCGCTGCAGAGGG + Intergenic
1062537693 9:137028104-137028126 TCCAGAGCAGCAGCTGCAGCTGG + Exonic
1062633712 9:137478846-137478868 TAGGAAGCAGCCGGTGCAGTGGG - Intronic
1185849006 X:3467965-3467987 TACAAAGCAACCTCTCCAGTAGG + Intergenic
1187871094 X:23766136-23766158 GACACACCAGCTGCTGCAGCTGG + Intronic
1187889207 X:23917796-23917818 TAAAATGCTGCCGCTGCTGCTGG + Intronic
1188362674 X:29275165-29275187 TACAAAGCAGGTGATGCTGCTGG - Intronic
1189383880 X:40521092-40521114 TACCAAGCAGCTTCTGCAGAGGG + Intergenic
1189992817 X:46610619-46610641 CTCAAAGCAGCAGCAGCAGCAGG + Intronic
1190260709 X:48795179-48795201 GACAAAGCAGCCCCTGGAGGTGG + Intergenic
1190935254 X:54993930-54993952 CACACAGCAGCGGCAGCAGCAGG - Exonic
1192762470 X:74107587-74107609 TACAAAGCATCAGATTCAGCAGG + Intergenic
1192773252 X:74215549-74215571 TACAAAGCAGCCCCTACAAGAGG + Intergenic
1196151758 X:112382066-112382088 CAGGAAGCAGCAGCTGCAGCAGG + Intergenic
1198694754 X:139324241-139324263 CACCATGCAGCTGCTGCAGCAGG - Intergenic
1200814657 Y:7518852-7518874 TACAAAGCAACCTCTCCAGTAGG - Intergenic