ID: 1083687247

View in Genome Browser
Species Human (GRCh38)
Location 11:64383881-64383903
Sequence CAGGGTAAGGGGAGGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083687237_1083687247 6 Left 1083687237 11:64383852-64383874 CCCTGGTGCTCTGAGGAGGTCTC No data
Right 1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG No data
1083687238_1083687247 5 Left 1083687238 11:64383853-64383875 CCTGGTGCTCTGAGGAGGTCTCC No data
Right 1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083687247 Original CRISPR CAGGGTAAGGGGAGGCTGGA TGG Intergenic
No off target data available for this crispr