ID: 1083687388

View in Genome Browser
Species Human (GRCh38)
Location 11:64384699-64384721
Sequence CTGCAGGTTGAGAGGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083687383_1083687388 -6 Left 1083687383 11:64384682-64384704 CCCTGGGATGCCTGAAACTGCAG No data
Right 1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG No data
1083687376_1083687388 21 Left 1083687376 11:64384655-64384677 CCCTGGGGCCTGGGAGACAGTGG No data
Right 1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG No data
1083687378_1083687388 20 Left 1083687378 11:64384656-64384678 CCTGGGGCCTGGGAGACAGTGGG No data
Right 1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG No data
1083687384_1083687388 -7 Left 1083687384 11:64384683-64384705 CCTGGGATGCCTGAAACTGCAGG No data
Right 1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG No data
1083687380_1083687388 13 Left 1083687380 11:64384663-64384685 CCTGGGAGACAGTGGGACACCCT No data
Right 1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083687388 Original CRISPR CTGCAGGTTGAGAGGCAGCC AGG Intergenic
No off target data available for this crispr