ID: 1083695491

View in Genome Browser
Species Human (GRCh38)
Location 11:64439569-64439591
Sequence CTCAAACTGCAGTGCTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083695480_1083695491 20 Left 1083695480 11:64439526-64439548 CCCGCAGAGCTGGGGAGACTCGG No data
Right 1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG No data
1083695488_1083695491 -6 Left 1083695488 11:64439552-64439574 CCCTGAAGAGCAGGGGTCTCAAA No data
Right 1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG No data
1083695482_1083695491 19 Left 1083695482 11:64439527-64439549 CCGCAGAGCTGGGGAGACTCGGG No data
Right 1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG No data
1083695478_1083695491 26 Left 1083695478 11:64439520-64439542 CCACTCCCCGCAGAGCTGGGGAG No data
Right 1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG No data
1083695489_1083695491 -7 Left 1083695489 11:64439553-64439575 CCTGAAGAGCAGGGGTCTCAAAC No data
Right 1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG No data
1083695479_1083695491 21 Left 1083695479 11:64439525-64439547 CCCCGCAGAGCTGGGGAGACTCG No data
Right 1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083695491 Original CRISPR CTCAAACTGCAGTGCTGGAA AGG Intergenic
No off target data available for this crispr