ID: 1083696291

View in Genome Browser
Species Human (GRCh38)
Location 11:64444910-64444932
Sequence CCACCTTGCCTGGCTAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083696287_1083696291 5 Left 1083696287 11:64444882-64444904 CCCACAATGTTGGGATTACAGGT 0: 9
1: 587
2: 13259
3: 122011
4: 343016
Right 1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG No data
1083696283_1083696291 18 Left 1083696283 11:64444869-64444891 CCTGTCTCAGTCACCCACAATGT No data
Right 1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG No data
1083696288_1083696291 4 Left 1083696288 11:64444883-64444905 CCACAATGTTGGGATTACAGGTG 0: 9
1: 599
2: 12100
3: 104601
4: 241924
Right 1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG No data
1083696282_1083696291 21 Left 1083696282 11:64444866-64444888 CCTCCTGTCTCAGTCACCCACAA No data
Right 1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083696291 Original CRISPR CCACCTTGCCTGGCTAAATC TGG Intergenic
No off target data available for this crispr