ID: 1083696341

View in Genome Browser
Species Human (GRCh38)
Location 11:64445304-64445326
Sequence CTGGCTAGGCAGGTCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083696341_1083696348 -4 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696348 11:64445323-64445345 CCAGCTCATTGATGGCAACTGGG No data
1083696341_1083696346 -5 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696346 11:64445322-64445344 GCCAGCTCATTGATGGCAACTGG No data
1083696341_1083696351 25 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696351 11:64445352-64445374 CTCCCCACTGAGTCACTGGTGGG No data
1083696341_1083696354 28 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696354 11:64445355-64445377 CCCACTGAGTCACTGGTGGGTGG No data
1083696341_1083696349 21 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696349 11:64445348-64445370 CATGCTCCCCACTGAGTCACTGG No data
1083696341_1083696350 24 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696350 11:64445351-64445373 GCTCCCCACTGAGTCACTGGTGG No data
1083696341_1083696356 29 Left 1083696341 11:64445304-64445326 CCCTGGCAGACCTGCCTAGCCAG No data
Right 1083696356 11:64445356-64445378 CCACTGAGTCACTGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083696341 Original CRISPR CTGGCTAGGCAGGTCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr