ID: 1083698264

View in Genome Browser
Species Human (GRCh38)
Location 11:64457048-64457070
Sequence TCCCCACAGAGTGAATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083698264_1083698268 -5 Left 1083698264 11:64457048-64457070 CCAGGGGATTCACTCTGTGGGGA No data
Right 1083698268 11:64457066-64457088 GGGGAAGCAGGTGCGGCAGTGGG No data
1083698264_1083698269 8 Left 1083698264 11:64457048-64457070 CCAGGGGATTCACTCTGTGGGGA No data
Right 1083698269 11:64457079-64457101 CGGCAGTGGGCACGTGACCGTGG No data
1083698264_1083698270 9 Left 1083698264 11:64457048-64457070 CCAGGGGATTCACTCTGTGGGGA No data
Right 1083698270 11:64457080-64457102 GGCAGTGGGCACGTGACCGTGGG No data
1083698264_1083698267 -6 Left 1083698264 11:64457048-64457070 CCAGGGGATTCACTCTGTGGGGA No data
Right 1083698267 11:64457065-64457087 TGGGGAAGCAGGTGCGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083698264 Original CRISPR TCCCCACAGAGTGAATCCCC TGG (reversed) Intergenic
No off target data available for this crispr