ID: 1083703847

View in Genome Browser
Species Human (GRCh38)
Location 11:64499736-64499758
Sequence CCGTGCCAGGCCTTTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083703847_1083703857 5 Left 1083703847 11:64499736-64499758 CCCATAGCAAAGGCCTGGCACGG No data
Right 1083703857 11:64499764-64499786 AGTGTGGGGAGCAGAGGATGGGG No data
1083703847_1083703856 4 Left 1083703847 11:64499736-64499758 CCCATAGCAAAGGCCTGGCACGG No data
Right 1083703856 11:64499763-64499785 CAGTGTGGGGAGCAGAGGATGGG No data
1083703847_1083703852 -10 Left 1083703847 11:64499736-64499758 CCCATAGCAAAGGCCTGGCACGG No data
Right 1083703852 11:64499749-64499771 CCTGGCACGGTGCACAGTGTGGG No data
1083703847_1083703853 -9 Left 1083703847 11:64499736-64499758 CCCATAGCAAAGGCCTGGCACGG No data
Right 1083703853 11:64499750-64499772 CTGGCACGGTGCACAGTGTGGGG No data
1083703847_1083703854 -1 Left 1083703847 11:64499736-64499758 CCCATAGCAAAGGCCTGGCACGG No data
Right 1083703854 11:64499758-64499780 GTGCACAGTGTGGGGAGCAGAGG No data
1083703847_1083703855 3 Left 1083703847 11:64499736-64499758 CCCATAGCAAAGGCCTGGCACGG No data
Right 1083703855 11:64499762-64499784 ACAGTGTGGGGAGCAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083703847 Original CRISPR CCGTGCCAGGCCTTTGCTAT GGG (reversed) Intergenic
No off target data available for this crispr