ID: 1083704560

View in Genome Browser
Species Human (GRCh38)
Location 11:64505145-64505167
Sequence ATCTTGTTCTAGGAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083704560_1083704566 18 Left 1083704560 11:64505145-64505167 CCCTGTCCCTCCTAGAACAAGAT 0: 1
1: 1
2: 0
3: 14
4: 215
Right 1083704566 11:64505186-64505208 TCAGTGAGTCAACTTCCCCTAGG 0: 1
1: 0
2: 1
3: 29
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083704560 Original CRISPR ATCTTGTTCTAGGAGGGACA GGG (reversed) Intergenic
901092450 1:6651039-6651061 CTGTCGTTCTAGAAGGGACAGGG + Intronic
901687674 1:10952682-10952704 GTCTTCTTTTAGGAGAGACAGGG + Intronic
902519758 1:17009564-17009586 ATTTTTTTTTAGTAGGGACAGGG + Intronic
902574727 1:17370423-17370445 ATCTTTTTTGAGGAAGGACAAGG - Intergenic
905724711 1:40241215-40241237 ACCTTGTTCTGGGATGGGCACGG - Intergenic
907572929 1:55500519-55500541 ATTTTGTTTTAGTAGAGACAAGG - Intergenic
908463662 1:64370322-64370344 ATATTGTTCAAGGAGTGGCAAGG + Intergenic
908617967 1:65944667-65944689 ATCTTGTTCTTGTATGGTCAGGG - Intronic
913100371 1:115558448-115558470 ACCCTGTTCTAGTAGGAACAAGG - Intergenic
913671272 1:121098573-121098595 ATATTTTCCTAGGAGGGCCAAGG + Intergenic
914661529 1:149793936-149793958 ATATTTTCCTAGGAGGGCCAAGG + Intronic
915222609 1:154386999-154387021 ATCTCCTTCTAGGAGGGAACAGG + Intergenic
916338752 1:163704152-163704174 ATCTTGTTATAGGAGGACAAAGG + Intergenic
916436487 1:164782399-164782421 ATCCTGGTCTAGCAGGGAGAAGG + Intronic
920732345 1:208499345-208499367 TTCTCGTTCTAGTAGGAACATGG - Intergenic
922502384 1:226106934-226106956 ATTTAGTTCTAGGCTGGACATGG + Intergenic
923013200 1:230105206-230105228 ATCATTCTCCAGGAGGGACAGGG + Intronic
923025460 1:230200392-230200414 TTCATGTTCTAGGAGGTAGAGGG - Intronic
923892040 1:238226844-238226866 ATCTTATTCAAGGAGAGATATGG + Intergenic
924786794 1:247206585-247206607 GCCTTGTTCTGGGAGGGACATGG + Intergenic
1063851221 10:10192941-10192963 TTCATGTTCTAGGTGGGAGAAGG + Intergenic
1064188546 10:13185286-13185308 ATCTTGTCCTAGGAGGGGTGAGG + Intronic
1068268555 10:54687837-54687859 ATATTGTTCAAGGATGGGCATGG - Intronic
1070665076 10:78337013-78337035 AACATGTTCTGGGAGGGCCAAGG + Intergenic
1071046840 10:81389191-81389213 TTCTTTTTTTAGGAGAGACAGGG - Intergenic
1072344257 10:94488211-94488233 GTATTGTTTTAGTAGGGACAGGG - Intronic
1072475009 10:95751544-95751566 ATTTTGTGTTAGGAGAGACAGGG - Intronic
1073358140 10:102873456-102873478 ATCTTCTTTTAGTAGAGACAGGG + Intronic
1075403276 10:122176479-122176501 CTCTTGTTCTGTGAGGGACTAGG + Intronic
1076466697 10:130687690-130687712 ATGTTTTTCTAGGATGGCCAGGG + Intergenic
1076630454 10:131849140-131849162 CTCTTGTTCTAGAATGAACAAGG + Intergenic
1077709396 11:4520760-4520782 ATCATGTCCTTGCAGGGACATGG - Intergenic
1079438210 11:20479815-20479837 ATCTGGATCCAGGAGGGAAATGG - Intronic
1081777721 11:45687398-45687420 ATGTTGTCTTAGTAGGGACAGGG - Intergenic
1081875302 11:46404455-46404477 TCCTTGCCCTAGGAGGGACAAGG + Intronic
1082109246 11:48255966-48255988 ATAGTGTTTCAGGAGGGACATGG + Intergenic
1083395884 11:62391612-62391634 ACCTTGTTCTATGTGGAACAGGG - Exonic
1083684918 11:64370210-64370232 ATCATGTACTAGGAGGGTGAGGG - Exonic
1083704560 11:64505145-64505167 ATCTTGTTCTAGGAGGGACAGGG - Intergenic
1084130502 11:67130315-67130337 ATATTGTTTTAGTAGAGACAGGG + Intronic
1085604169 11:77882463-77882485 GTATTGTTTTGGGAGGGACAAGG - Intronic
1087637186 11:100715312-100715334 ATCCTGTTCTACAAAGGACAAGG - Intronic
1088992006 11:114961741-114961763 AGCTTCTACTAGGAGGGAAACGG - Intergenic
1089090096 11:115866030-115866052 ATCATGTCCTTGCAGGGACATGG - Intergenic
1091214403 11:133891795-133891817 ATCTTGGGCTAGGAGGCAGAGGG - Intergenic
1093909514 12:24729998-24730020 TTCTTGTTTTTGTAGGGACATGG - Intergenic
1094276747 12:28685610-28685632 TCCGTGTTCTAGGAGGGACCAGG - Intergenic
1095627458 12:44333450-44333472 GACTTGTTGTGGGAGGGACATGG + Intronic
1096112820 12:49039351-49039373 CTCTTGTCCTAGAAGAGACAAGG + Exonic
1096293647 12:50364378-50364400 ATTTTTTTTTAGGAGAGACAGGG - Intronic
1096367425 12:51040454-51040476 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1096842313 12:54387114-54387136 ATCTTGTTCAAGGAGAGGAAGGG + Intronic
1099313273 12:81054243-81054265 ATCATGTTCTTGCAGGGACATGG + Intronic
1100219233 12:92485906-92485928 ATATTTTTCTAGTAGAGACAGGG - Intergenic
1101616440 12:106342489-106342511 ATGGTGTTCTAGGAGGAAGAGGG + Intronic
1102596710 12:113998440-113998462 ATTTTTTTCTAGTAGAGACAGGG - Intergenic
1103272128 12:119682030-119682052 ACCTTTTTGGAGGAGGGACACGG - Intergenic
1105244613 13:18637764-18637786 TTCATGTTTTTGGAGGGACATGG + Intergenic
1105254379 13:18732153-18732175 ATCCTGTTCTAGGAACAACAAGG - Intergenic
1106049797 13:26179506-26179528 CTCCTGTTCTGGGAGGGACAAGG + Intronic
1108615305 13:52127055-52127077 ATTTTTTTTTAGCAGGGACAGGG + Intronic
1109215271 13:59582810-59582832 TTCTGCTTCTAGGAGGGCCAAGG - Intergenic
1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG + Intergenic
1112175790 13:97022497-97022519 CCCTTGTTCTAGCAGGTACATGG + Intergenic
1112210997 13:97376940-97376962 ATATTGTTCTAGGCAGGACATGG - Intronic
1115613398 14:35070312-35070334 ATATTGTTATAGGCCGGACACGG - Intronic
1117544576 14:56782025-56782047 ATTTTGTTGTAGTAGAGACAAGG + Intergenic
1118763218 14:68893286-68893308 ATCTGGTTCTAAGAGGGTGAGGG - Intronic
1118822079 14:69352318-69352340 AGCTTGTTCTAGGAGGGCGCAGG + Intronic
1118863328 14:69682846-69682868 AGCCTGTTCTAGGAGAGACAGGG - Intronic
1120058954 14:79959370-79959392 ATCATGTCCTTTGAGGGACATGG + Intergenic
1120114344 14:80595964-80595986 CATTTGTTCTGGGAGGGACACGG - Intronic
1121095741 14:91216989-91217011 AGCTTGCTCTAAGAGGGCCATGG - Intronic
1121349501 14:93162145-93162167 ATCTTTTTCTATGGGGGTCAAGG - Intergenic
1124063990 15:26322620-26322642 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1124230045 15:27936724-27936746 TTCTGGGTCTAGGAGGGAGAGGG - Intronic
1125648302 15:41291936-41291958 AGCTGGTTCTAAGAGGGTCATGG - Intergenic
1127037919 15:54939915-54939937 ATCTTGTTCTAGCAAGGAGGTGG - Intergenic
1129407235 15:75327801-75327823 ACCTTGGTCTAGGTGGGAAAGGG + Intergenic
1131320257 15:91382590-91382612 ATCATGTCCTTGCAGGGACATGG + Intergenic
1133838371 16:9386437-9386459 ATTTTCTCCCAGGAGGGACAGGG + Intergenic
1133906258 16:10025472-10025494 TTCTTTTTTTTGGAGGGACAGGG + Intronic
1134189400 16:12109626-12109648 ATCTGGAGCAAGGAGGGACATGG + Intronic
1135657906 16:24267576-24267598 ATTTTTTTCTAGGTGGGGCACGG - Intronic
1137464102 16:48692375-48692397 AGGCTGTTCTAGCAGGGACAGGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139319630 16:66103530-66103552 GTCTTGTTCTAAGAGACACAAGG + Intergenic
1140256916 16:73345546-73345568 ATCATGTCCTCGCAGGGACATGG - Intergenic
1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG + Intronic
1143688760 17:8542191-8542213 CTCTTGTTCTAGGATAAACATGG + Exonic
1143981376 17:10873127-10873149 GTCTTTTTCTAGAAGGGCCATGG + Intergenic
1144688993 17:17247232-17247254 GCTTTGTTCTGGGAGGGACAGGG - Intronic
1147369843 17:39984771-39984793 CTGTTGTTCTAGGAGAGAGAAGG + Intronic
1150428474 17:65096579-65096601 ATCATGTCATAGCAGGGACATGG + Intergenic
1151785578 17:76273403-76273425 GTCTTTTTCTAGGAGGGGAATGG + Intergenic
1153492081 18:5659896-5659918 ATCTGTTTCTAGGACAGACATGG - Intergenic
1153948953 18:10041297-10041319 ATCCTGTTCTGGGAGGAATAAGG - Intergenic
1154436649 18:14348469-14348491 ATCCTGTTCTAGGAACAACAAGG + Intergenic
1155678930 18:28465890-28465912 ATCCTATTCTAGAAGGGACAAGG + Intergenic
1157559321 18:48635497-48635519 CTTTTGTTTTAGTAGGGACAAGG + Intronic
1158241355 18:55382014-55382036 ATCTTTTTCAAGGAAGGTCAAGG - Intronic
1159265397 18:66072964-66072986 ATATTGTCATAGGAGGGACCTGG - Intergenic
1160501884 18:79405614-79405636 CCCTTCTTCTAGGAGGAACAAGG + Intronic
1162658455 19:12150670-12150692 ATCTTTTTTTACAAGGGACAGGG + Intronic
1162987938 19:14283663-14283685 ATATTTTTTTAGTAGGGACAAGG + Intergenic
1163322037 19:16580543-16580565 ATTTTTTTTTAGTAGGGACAGGG + Intronic
1167675127 19:50879095-50879117 ATGTTGTTGAAGGAGGGACTAGG + Exonic
925254253 2:2468708-2468730 GTCTTTTCCTAGGAGGAACAAGG + Intergenic
925396257 2:3535684-3535706 ATTTTATTCTGAGAGGGACAAGG + Intronic
925691467 2:6528442-6528464 ATCATGTCCTTGCAGGGACATGG + Intergenic
927894270 2:26771390-26771412 AGTTTCCTCTAGGAGGGACAAGG - Intronic
928158015 2:28894493-28894515 ATCTTGTTCTGGGCGGGAGTGGG - Intergenic
928362840 2:30679564-30679586 ATCCTGGGCTAGGAGGCACAGGG + Intergenic
929691321 2:44076329-44076351 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
930068868 2:47349362-47349384 ATCTTTTTCTTGGACGGGCATGG + Intronic
930720372 2:54632139-54632161 TTCTTGCTCTAGAAGGGTCAGGG + Intronic
931531606 2:63221009-63221031 ATCATGTCCTTTGAGGGACAGGG - Intronic
932214777 2:69959561-69959583 AGCTTCTTCTTGGAGGGACTTGG - Intergenic
933483056 2:82881563-82881585 ATCATGTTTTTGCAGGGACATGG + Intergenic
934077958 2:88443761-88443783 ATTTTGTCCTGGGAGGGACTTGG + Intergenic
934489335 2:94749040-94749062 ATCCTGTTCTAGGAACAACAAGG - Intergenic
936615468 2:114043437-114043459 ATCCTGTTCTAGGAGGAATGAGG - Intergenic
936830289 2:116636817-116636839 ATCTTTTTTTAGAAGAGACAGGG - Intergenic
937822256 2:126323593-126323615 ATTCTGTTCTAGGAAGGACTTGG + Intergenic
938278644 2:130049770-130049792 GTCATGTTCTGGGAGGGATAAGG - Intergenic
938329618 2:130440629-130440651 GTCATGTTCTGGGAGGGATAAGG - Intergenic
938360328 2:130680874-130680896 GTCATGTTCTGGGAGGGATAAGG + Intergenic
938436730 2:131287582-131287604 GTCATGTTCTGGGAGGGATAAGG + Intronic
939514585 2:143150824-143150846 AACGTGTTCTAGGAAGAACAAGG + Intronic
939752576 2:146065217-146065239 CACTTGTTCTGGGAGGGACCTGG - Intergenic
940979516 2:159985914-159985936 ATCCTATTCTAGGAGGGATAAGG - Intronic
942208789 2:173650068-173650090 GTCCTTTTCTAGGAAGGACATGG + Intergenic
943112868 2:183627541-183627563 ATGTTGATATAGGAGGGAGAGGG + Intergenic
944015103 2:195026558-195026580 ATCATTTTCTAGGAGTTACATGG + Intergenic
944187213 2:196962183-196962205 ATCTGGTTCTGGGAGGGACCAGG + Intergenic
945782013 2:214186934-214186956 ATTTTGTTTTAGTAGAGACAGGG + Intronic
947393145 2:229660428-229660450 ATCATGTCCTTGCAGGGACATGG - Intronic
948016633 2:234696558-234696580 ATCTTGTTGTGGAAGGGACCTGG - Intergenic
948837296 2:240631915-240631937 GTCATGTTCTGGCAGGGACATGG + Intergenic
1169435964 20:5590366-5590388 ATATTGTTTTAGTAGAGACAGGG - Intronic
1170006084 20:11670602-11670624 AGCATGTTCTAGGAGAGAAAAGG - Intergenic
1170766889 20:19297898-19297920 ATCTTGTGCTAGGAAGGGAAGGG + Intronic
1174498136 20:50964087-50964109 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1174498567 20:50967296-50967318 TTCTTGGTCTAGGAGGGAGATGG - Intergenic
1175245960 20:57582080-57582102 GTCTTGTACCAGGATGGACAGGG - Intergenic
1176840395 21:13837186-13837208 ATCCTGTTCTAGGAACAACAAGG - Intergenic
1178092966 21:29183730-29183752 ATTTTTTTCTAGCAGAGACAGGG + Intergenic
1181371195 22:22418264-22418286 ATCTTTTTTTAGTAGAGACAGGG - Intergenic
1183956764 22:41385189-41385211 ATTTTGTTTTAGTAGAGACAGGG - Intronic
950860931 3:16146676-16146698 ATTTTTTTTTTGGAGGGACAGGG + Intergenic
951946192 3:28139450-28139472 ATCCTGTTCTAGGAGAAACGAGG - Intergenic
951969915 3:28432081-28432103 CACATGTTGTAGGAGGGACATGG - Intronic
952293387 3:32039974-32039996 ATCTTGACCAAGGAAGGACATGG + Intronic
954230039 3:49209888-49209910 ATATTGTTTTAGTAGAGACAGGG + Intronic
954633583 3:52059554-52059576 AGCTTGTTTCAGGAGGGAGAGGG + Intergenic
960170554 3:114455598-114455620 ATCTAGATCTTGGAGGGAGAAGG + Intronic
960434599 3:117610287-117610309 ATCCTGTTCTAGGAAGAAAAAGG - Intergenic
960572957 3:119203485-119203507 ATCATGTTTTTGCAGGGACATGG + Intronic
968554209 4:1239105-1239127 ATCTGGTTCTGGGAAGGTCAGGG - Intronic
969358478 4:6645978-6646000 ATCTTGTCCTGGGAGTGACCCGG + Intergenic
969623596 4:8291355-8291377 AGCTTTTTCTAGGAGAGAGAAGG - Exonic
969892792 4:10275320-10275342 AGCTTGATCTAGGAGGTACAGGG + Intergenic
972616243 4:40701079-40701101 TTCTTGTTTTAGTAGAGACAGGG - Intergenic
974479967 4:62430398-62430420 CTCTGGATCCAGGAGGGACAGGG + Intergenic
974707843 4:65544909-65544931 ATCGTGTCCTTGCAGGGACATGG + Intronic
974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG + Intergenic
975890828 4:79024859-79024881 ATCTAGTTCAATGAGGGAGAGGG - Intergenic
975978095 4:80122013-80122035 ATAGTGTTCTTGCAGGGACATGG + Intronic
976491757 4:85678837-85678859 ATTTTGTTATAGGAAGTACAAGG + Intronic
976794392 4:88916107-88916129 TTCTTGCTCTAGGTGGTACAGGG - Intronic
985009281 4:185566029-185566051 ATCTGGCTCTAGCAAGGACACGG + Intergenic
986473038 5:8094643-8094665 ATCTTATCCTCTGAGGGACATGG - Intergenic
987060441 5:14238197-14238219 ATTTTGTTCTTGGAGGGATAGGG + Intronic
987280344 5:16407472-16407494 ATTTTGTTTTAGTAGAGACAGGG + Intergenic
989217183 5:38917464-38917486 ACCTTTTTCTAGGACGGTCAAGG - Intronic
989511069 5:42288204-42288226 ATCCGGTTCTATGAGGGAAAAGG - Intergenic
990206264 5:53432874-53432896 ATCTTCTTCTAGAATGGATAAGG + Intergenic
990781833 5:59373141-59373163 AGCTTGCTTTAGAAGGGACACGG - Intronic
992327344 5:75673779-75673801 ATCTTTTTTTAGTAGAGACAAGG - Intergenic
992593682 5:78324007-78324029 CTCTTTTTTTAGGTGGGACAGGG + Intergenic
995636710 5:114201579-114201601 TGCTTGGTCAAGGAGGGACAGGG - Intergenic
997712151 5:136014946-136014968 ATCTTGTTCTAGGAAGAGTAAGG + Intergenic
997764113 5:136482098-136482120 GTTTTGTTTTAGGAGTGACAGGG - Intergenic
998046949 5:138995411-138995433 ATTTTGTTTTAGTAGAGACAGGG + Intronic
998286744 5:140870161-140870183 CTCTCGTACTGGGAGGGACAAGG - Exonic
999050775 5:148521983-148522005 CACTTGTTATAGGAGGGACCTGG + Intronic
999184998 5:149700652-149700674 ATATTTTTCAAGGAGGGGCATGG + Intergenic
999839618 5:155411212-155411234 ATCTTGCTTTAGGAAGAACAGGG - Intergenic
1001423320 5:171603609-171603631 ATCATGTTCTAGGAGGGCTTGGG - Intergenic
1001535559 5:172495485-172495507 AGCCTGTTCTGGGAGGGACTGGG + Intergenic
1003614278 6:7641290-7641312 ATCCTGTTCTAGGAGGGATGAGG + Intergenic
1003740887 6:8937688-8937710 ATCATGTCCTTGCAGGGACATGG - Intergenic
1005376848 6:25191565-25191587 ATCTTGTTATATGAGAGGCAAGG - Intergenic
1006056498 6:31389143-31389165 ATCTTGGTCTAAGTGGGAAAGGG + Intergenic
1006069223 6:31486122-31486144 ATCTTGGTCTAAGTGGGAAAGGG + Intergenic
1012008185 6:93743459-93743481 TTCTTATTCTTTGAGGGACAGGG - Intergenic
1014163652 6:118199145-118199167 ATCCTGTTCTAGGAAGGATGAGG + Intronic
1015008089 6:128309281-128309303 ATCTTTTCCTAATAGGGACATGG + Intronic
1016001038 6:139041531-139041553 ATTTTTTTTTAGGAGAGACATGG + Intronic
1016090699 6:139975609-139975631 ATTTTGTTCTATGGGGGAGATGG + Intergenic
1018628577 6:165803860-165803882 TACTTGGTGTAGGAGGGACAAGG + Intronic
1021678069 7:23100952-23100974 ACCCTGTTCTGGGAGGAACAAGG + Intergenic
1023123806 7:36935395-36935417 ATTTTTTTTTAGAAGGGACAAGG - Intronic
1023140764 7:37100227-37100249 AGCTTTGTCTAGGAGGAACAGGG - Intronic
1033745851 7:144316641-144316663 ATCTTGTCCTTTGATGGACATGG - Intergenic
1034732865 7:153403207-153403229 AGCTTGATCTAGCAAGGACAAGG - Intergenic
1038482044 8:27908626-27908648 ATGTTGTATTAGGAGGGAAAAGG - Intronic
1041403129 8:57465472-57465494 ATCTTGTTGTAAAAGGGAAAGGG + Intergenic
1043265634 8:78264952-78264974 TTCTAGTTTTAGTAGGGACAGGG - Intergenic
1043506259 8:80906342-80906364 ATCTCGTTTTGTGAGGGACAGGG + Intergenic
1044442233 8:92236462-92236484 CACTTGTTGTAGGAGGGACCTGG - Intergenic
1045823408 8:106368707-106368729 ATCATGTTTTTGCAGGGACATGG - Intronic
1048107655 8:131428687-131428709 CTCTTGTTGTGGGAGGGACCTGG - Intergenic
1049586483 8:143434805-143434827 ACCTGGTACGAGGAGGGACAGGG + Intergenic
1053145990 9:35712469-35712491 ATTTTGTTTTAGTAGAGACAGGG - Intronic
1053668449 9:40335243-40335265 ATCCTGTTCTAGGAACAACAAGG + Intergenic
1054379589 9:64475295-64475317 ATCCTGTTCTAGGAACAACAAGG + Intergenic
1057812842 9:98270929-98270951 ATCTTTCTCAAGGGGGGACAGGG + Intergenic
1058853128 9:109032728-109032750 ATCTAATTCTATGCGGGACATGG - Intronic
1059076123 9:111195747-111195769 ATCTTGTTCTGGGAATGTCAGGG + Intergenic
1061536363 9:131252605-131252627 ATGTTCTTTTAGGAGTGACAAGG - Intergenic
1187841462 X:23493385-23493407 ATCTTCTTCTGGGAGTGAAATGG - Intergenic
1188694566 X:33174592-33174614 ACCTTGTACTGGGATGGACAAGG + Intronic
1188823854 X:34805884-34805906 ATCTTGACCTAGGAGGGAAGAGG - Intergenic
1190002879 X:46706664-46706686 ATCTGGTTCTCACAGGGACAGGG - Intronic
1193172800 X:78356571-78356593 ATTTTGTTTTAGTAGAGACACGG + Intergenic
1193308729 X:79979903-79979925 ATCATGTTTTGGGGGGGACATGG - Intergenic
1195708017 X:107752136-107752158 AGCTTGTGCTAGAAGGGAGAAGG + Intronic
1195964021 X:110413804-110413826 ATCATGTTCCAGGATGGAGAGGG - Intronic
1201226611 Y:11824702-11824724 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1202017273 Y:20423186-20423208 ATCTTATTCCTGAAGGGACAAGG + Intergenic