ID: 1083705189

View in Genome Browser
Species Human (GRCh38)
Location 11:64509264-64509286
Sequence GTGTAGGCCATCAGGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083705189_1083705198 10 Left 1083705189 11:64509264-64509286 CCGACCTCCCTGATGGCCTACAC No data
Right 1083705198 11:64509297-64509319 TAAAGGCAGCGGTAAATTTCAGG No data
1083705189_1083705197 -1 Left 1083705189 11:64509264-64509286 CCGACCTCCCTGATGGCCTACAC No data
Right 1083705197 11:64509286-64509308 CACGAGGGTTGTAAAGGCAGCGG No data
1083705189_1083705196 -7 Left 1083705189 11:64509264-64509286 CCGACCTCCCTGATGGCCTACAC No data
Right 1083705196 11:64509280-64509302 CCTACACACGAGGGTTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083705189 Original CRISPR GTGTAGGCCATCAGGGAGGT CGG (reversed) Intergenic
No off target data available for this crispr