ID: 1083705420

View in Genome Browser
Species Human (GRCh38)
Location 11:64510892-64510914
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083705420_1083705421 -9 Left 1083705420 11:64510892-64510914 CCATCACACTATTTCTGCTTTTG No data
Right 1083705421 11:64510906-64510928 CTGCTTTTGAGAGAGTTCTCAGG No data
1083705420_1083705422 -2 Left 1083705420 11:64510892-64510914 CCATCACACTATTTCTGCTTTTG No data
Right 1083705422 11:64510913-64510935 TGAGAGAGTTCTCAGGACCCTGG No data
1083705420_1083705423 3 Left 1083705420 11:64510892-64510914 CCATCACACTATTTCTGCTTTTG No data
Right 1083705423 11:64510918-64510940 GAGTTCTCAGGACCCTGGAGAGG No data
1083705420_1083705424 13 Left 1083705420 11:64510892-64510914 CCATCACACTATTTCTGCTTTTG No data
Right 1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG No data
1083705420_1083705427 23 Left 1083705420 11:64510892-64510914 CCATCACACTATTTCTGCTTTTG No data
Right 1083705427 11:64510938-64510960 AGGCACCGCCTGGCTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083705420 Original CRISPR CAAAAGCAGAAATAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr