ID: 1083705424

View in Genome Browser
Species Human (GRCh38)
Location 11:64510928-64510950
Sequence GACCCTGGAGAGGCACCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083705418_1083705424 22 Left 1083705418 11:64510883-64510905 CCTGGCCAACCATCACACTATTT No data
Right 1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG No data
1083705419_1083705424 17 Left 1083705419 11:64510888-64510910 CCAACCATCACACTATTTCTGCT No data
Right 1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG No data
1083705420_1083705424 13 Left 1083705420 11:64510892-64510914 CCATCACACTATTTCTGCTTTTG No data
Right 1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083705424 Original CRISPR GACCCTGGAGAGGCACCGCC TGG Intergenic
No off target data available for this crispr