ID: 1083705566

View in Genome Browser
Species Human (GRCh38)
Location 11:64511990-64512012
Sequence TCATCTCTATGGTTTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083705558_1083705566 10 Left 1083705558 11:64511957-64511979 CCGAGTGCCCTGGGTGGCAGGTG No data
Right 1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG No data
1083705562_1083705566 3 Left 1083705562 11:64511964-64511986 CCCTGGGTGGCAGGTGGGGAGAA No data
Right 1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG No data
1083705551_1083705566 30 Left 1083705551 11:64511937-64511959 CCAGTCCCTGGCATCTGTCTCCG No data
Right 1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG No data
1083705552_1083705566 25 Left 1083705552 11:64511942-64511964 CCCTGGCATCTGTCTCCGAGTGC No data
Right 1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG No data
1083705563_1083705566 2 Left 1083705563 11:64511965-64511987 CCTGGGTGGCAGGTGGGGAGAAG No data
Right 1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG No data
1083705553_1083705566 24 Left 1083705553 11:64511943-64511965 CCTGGCATCTGTCTCCGAGTGCC No data
Right 1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083705566 Original CRISPR TCATCTCTATGGTTTGCTGA AGG Intergenic
No off target data available for this crispr