ID: 1083706337

View in Genome Browser
Species Human (GRCh38)
Location 11:64518843-64518865
Sequence CCAGAATTGACCCCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083706337_1083706343 10 Left 1083706337 11:64518843-64518865 CCTGGAGTAGGGGTCAATTCTGG No data
Right 1083706343 11:64518876-64518898 TTGCTGCTCCCTCCAGTGTAGGG No data
1083706337_1083706345 12 Left 1083706337 11:64518843-64518865 CCTGGAGTAGGGGTCAATTCTGG No data
Right 1083706345 11:64518878-64518900 GCTGCTCCCTCCAGTGTAGGGGG No data
1083706337_1083706342 9 Left 1083706337 11:64518843-64518865 CCTGGAGTAGGGGTCAATTCTGG No data
Right 1083706342 11:64518875-64518897 CTTGCTGCTCCCTCCAGTGTAGG No data
1083706337_1083706344 11 Left 1083706337 11:64518843-64518865 CCTGGAGTAGGGGTCAATTCTGG No data
Right 1083706344 11:64518877-64518899 TGCTGCTCCCTCCAGTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083706337 Original CRISPR CCAGAATTGACCCCTACTCC AGG (reversed) Intergenic
No off target data available for this crispr