ID: 1083707277

View in Genome Browser
Species Human (GRCh38)
Location 11:64525208-64525230
Sequence CCCCCCGCACATCTGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083707266_1083707277 5 Left 1083707266 11:64525180-64525202 CCCTGCTGGTGCCCCCTGAGAGC No data
Right 1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG No data
1083707267_1083707277 4 Left 1083707267 11:64525181-64525203 CCTGCTGGTGCCCCCTGAGAGCC No data
Right 1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG No data
1083707269_1083707277 -7 Left 1083707269 11:64525192-64525214 CCCCTGAGAGCCTCCACCCCCCG No data
Right 1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG No data
1083707271_1083707277 -9 Left 1083707271 11:64525194-64525216 CCTGAGAGCCTCCACCCCCCGCA No data
Right 1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG No data
1083707268_1083707277 -6 Left 1083707268 11:64525191-64525213 CCCCCTGAGAGCCTCCACCCCCC No data
Right 1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG No data
1083707270_1083707277 -8 Left 1083707270 11:64525193-64525215 CCCTGAGAGCCTCCACCCCCCGC No data
Right 1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083707277 Original CRISPR CCCCCCGCACATCTGGGCAC AGG Intergenic
No off target data available for this crispr